+350 Jornalistas e Apresentadoras mais belas do Brasil e do Mundo

Atualizado em 01 de julho de 2015 | Quando resolvi criar uma lista que reunisse as mais belas jornalistas da TV, não imaginei o sucesso que seria. Começou com cerca de 30 nomes, pois apesar de vivermos num país imenso, fiquei restrito à emissoras com alcance nacional. Aí me mudei para a baixada santista e conheci novos nomes, de emissoras da região. Em pouquíssimo tempo passei a receber comentários e e-mails com sugestões de nomes das mais diversas emissoras locais espalhadas pelo Brasil.

Atendi também uma sugestão para abrir o leque e incluir apresentadoras. O resultado está aqui: mais de 350 lindas jornalistas a apresentadoras da TV brasileira.

Óbvio, seria muita pretensão querer que TODAS estivessem aqui. Quase impossível; ou talvez nem tanto. Conto, ou melhor, continuo a contar com a sua sugestão para que esta lista se torne – se já não for – a maior da internet a reunir nossas lindas e talentosas mulheres de televisão. E vale nomes de canais de TV paga também. Participe!

E no final do post, um bônus: Top 10 das jornalistas mais lindas do mundo!

Enquete: Onde estão as mais belas jornalistas e apresentadoras?

Jornalistas e apresentadoras de TV mais lindas do Brasil

Jornalistas e Apresentadoras mais belas da TV

Adriana Araújo

Adriana Araújo

Adriana Bittar

Adriana Bittar

Adriana Perroni

Adriana Perroni

Adriana Reid

Adriana Reid

Adriane Galisteu

Adriane Galisteu

Agda Queiroz

Agda Queiroz

Akemí Duarte

Akemí Duarte

Alana Rodrigues

Alana Rodrigues

Alessandra Consoli

Alessandra Consoli

Alice Bastos Neves

Alice Bastos Neves

Aline Bordalo

Aline Bordalo

Aline Machado

Aline Machado

Aline Malafaia

Aline Malafaia

Amanda Couto

Amanda Couto

Amanda Foschini

Amanda Foschini

Amanda Françozo

Amanda Françozo

Amanda Klein

Amanda Klein

Ana Bertozzo

Ana Bertozzo

Ana Carolina Oleksy

Ana Carolina Oleksy

Ana Cristina Pimenta

Ana Cristina Pimenta

Ana Elise Zogheib

Ana Elise Zogheib

Ana Furtado

Ana Furtado

Ana Hickmann

Ana Hickmann

Ana Luiza Castro

Ana Luiza Castro

Ana Paula Araújo

Ana Paula Araújo

Ana Paula Campos

Ana Paula Campos

Ana Paula Couto

Ana Paula Couto

Ana Paula Padrão

Ana Paula Padrão

Analice Nicolau

Analice Nicolau

Andrea Beron

Andrea Beron

Andrea Bueno

Andrea Bueno

Andressa Guaraná

Andressa Guaraná

Andressa Missio

Andressa Missio

Andressa Ramirez

Andressa Ramirez

Andressa Wolff

Andressa Wolff

Anelise de Oliveira

Anelise de Oliveira

Angélica

Angélica

Anita Paschkes

Anita Paschkes

Anne Lottermann

Anne Lottermann

Audrey Kleys

Audrey Kleys

Aurora Bello

Aurora Bello

Barbara Coelho

Barbara Coelho

Bianca Jhordão

Bianca Jhordão

Bianca Rothier

Bianca Rothier

Bruna Calmon

Bruna Calmon

Bruna Ramos Boyer

Bruna Ramos Boyer

Camila Bomfim

Camila Bomfim

Camila Busnello

Camila Busnello

Camille Reis

Camille Reis

Candida Oliveira

Candida Oliveira

Carina Pereira

Carina Pereira

Carla Cecato

Carla Cecato

Carla Fachim

Carla Fachim

Carla Vilhena

Carla Vilhena

Carol Barcellos

Carol Barcellos

Carol Guedes

Carol Guedes

Carol Minhoto

Carol Minhoto

Carol Nakamura

Carol Nakamura

Carolina Aguaidas

Carolina Aguaidas

Carolina Castelo Branco

Carolina Castelo Branco

Carolina Facchina

Carolina Facchina

Carolina Thomeu

Carolina Thomeu

Caroline Nogueira

Caroline Nogueira

Catarina Hong

Catarina Hong

Cátia Fonseca

Cátia Fonseca

Cecília Malan

Cecília Malan

Chris Flores

Chris Flores

Chris Nicklas

Chris Nicklas

Christiane Pelajo

Christiane Pelajo

Cíntia Lima

Cíntia Lima

Claudia Barthel

Claudia Barthel

Claudia Reis

Claudia Reis

Cristiane Dias

Cristiane Dias

Cristina Lyra

Cristina Lyra

Cristina Vieira

Cristina Vieira

Cynthia Benini

Cynthia Benini

Daiana Garbin

Daiana Garbin

Dani Calabresa

Dani Calabresa

Dani Monteiro

Dani Monteiro

Daniela Albuquerque

Daniela Albuquerque

Daniela Boaventura

Daniela Boaventura

Daniela Freitas

Daniela Freitas

Daniella Cicarelli

Daniella Cicarelli

Débora Aguillar

Débora Aguillar

Débora de Oliveira

Débora de Oliveira

Débora Vilalba

Débora Vilalba

Denise Félix

Denise Félix

Denise Luque

Denise Luque

Diana Bouth

Diana Bouth

Didi Wagner

Didi Wagner

Edieni Ferigollo

Edieni Ferigollo

Eliana

Eliana

Elaine Bast

Elaine Bast

Ellen Jabour

Ellen Jabour

Erica Reis

Erica Reis

Fabiana Do Nascimento

Fabiana do Nascimento

Fabiana Fatoreto

Fabiana Fatoreto

Fabiana Oliveira

Fabiana Oliveira

Fabiana Panachão

Fabiana Panachão

Fabiana Scaranzi

Fabiana Scaranzi

Fabiane Kaczan

Fabiane Kaczan

Fátima Bernardes

Fátima Bernardes

Fernanda Burger

Fernanda Burger

Fernanda Gentil

Fernanda Gentil

Fernanda Lima

Fernanda Lima

Flavia Alvarenga

Flavia Alvarenga

Flávia Bonato

(À direita de Fabi Boal)
Flavia-Bonato

Flávia Freire

Flávia Freire

Flávia Noronha

Flávia Noronha

Flávia Peres

Flávia Peres

Flávia Ribeiro

Flávia Ribeiro

Flávia Scalzo

Flávia Scalzo

Gabriela França

Gabriela França

Gabriela Lisbôa

Gabriela Lisbôa

Gabriela Pasqualin

Gabriela Pasqualin

Gabriella Bordasch

Gabriella Bordasch

Geovanna Tominaga

Geovanna Tominaga

Gianne Albertoni

Gianne Albertoni

Gil Jung

Gil Jung

Gisah Batista

Gisah Batista

Gisele Ramos

Gisele Ramos

Giselle Hishida

Giselle Hishida

Gislaine Ferreira

Gislaine Ferreira

Glenda Kozlowski

Glenda Kozlowski

Glória Vanique

Glória Vanique

Greyce Feijão

Greyce Feijão

Heaven Delhaye

Heaven Delhaye

Heloísa Gomyde

Heloísa Gomyde

Ilze Scamparini

Ilze Scamparini

Ingrid Griebel

Ingrid Griebel

Isabela Labate

Isabela Labate

Isabela Tacaki

Isabela Tacaki

Isabella Fiorentino

Isabella Fiorentino

Izabella Camargo

Izabella Camargo

Izabela Drumond

Izabela Drumond

Jacqueline Brazil

Jacqueline Brazil

Janaina Jacobina

Janaina Jacobina

Janine Borba

Janine Borba

Jeniffer Cabello

Jeniffer Cabello

Jessica Biot

Jessica Biot

Jessica Leão

Jessica Leão

Jéssica Senra

Jéssica Senra

Jhenny Andrade

Jhenny Andrade

Joanna de Assis

Joanna de Assis

Joice Hasselmann

Joice Hasselmann

Joyce Ribeiro

Joyce Ribeiro

Julia Petit

Julia Petit

Juliana Franceschi

Juliana Franceschi

Juliana Góes

Juliana Góes

Juliana Perdigão

Juliana Perdigão

Juliana Rios

Juliana Rios

Juliana Silveira

Juliana Silveira

Juliana Veiga

Juliana Veiga

Juliana Verboonen

Juliana Verboonen

Kalinka Schutel

Kalinka Schutel

Karen Jonz

Karen Jonz

Karina Oliani

Karina Oliani

Karina Pachiega

Karina Pachiega

Karyn Bravo

Karyn Bravo

Kátia Scanferla

Kátia Scanferla

Katiúscia Neri

Katiúscia Neri

Kelly Pedrita

Kelly Pedrita

Keltryn Wendland

Keltryn Wendland

Laís Lacerda

Laís Lacerda

Larissa Erthal

Larissa Erthal

Larissa Israel

Larissa Israel

Leilane Neubarth

Leilane Neubarth

Letícia Gil

Letícia Gil

Letícia Henrique

Letícia Henrique

Letícia Levy

Letícia Levy

Letícia Wiermann

Letícia Wiermann

Lidiane Shayuri

Lidiane Shayuri

Ligia Mendes

Ligia Mendes

Liliam Queiroz

Liliam Queiroz

Lívia Braz

Lívia Braz

Lívia Raick

Lívia Raick

Lizi Benites

Lizi Benites

Lorena Calábria

Lorena Calábria

Louise Calegari

Louise Calegari

Luana Piovani

Luana Piovani

Luciana Ávila

Luciana Ávila

Luciana Camargo

Luciana Camargo

Luciana Gimenez

Luciana Gimenez

Luciana Magalhães

Luciana Magalhães

Luciana Yurie

Luciana Yurie

Luisa Mell

Luisa Mell

Luisa Micheletti e Erika Mader

Luisa Micheletti e Erika Mader

Luiza Zanchetta

Luiza Zanchetta

Luize Altenhofen

Luize Altenhofen

Maíra Lemos

Maíra Lemos

Maira Morais

Maira Morais

Manuela Queiroz

Manuela Queiroz

Mara Pinheiro

Mara Pinheiro

Marcela Silvestri

Marcela Silvestri

Marcela Varani

(À direita de Juliana Silveira)
Marcela Varani

Marcela Verasquim

Marcela Verasquim

Marcela Warzee

Marcela Warzee

Marcia Dantas

Marcia Dantas

Maria Beltrão

Maria Beltrão

Maria Cândida

Maria Cândida

Maria Júlia Coutinho

Maria Júlia Coutinho

Maria Paula Carvalho

Maria Paula Carvalho

Maria Paula Limah

Maria Paula Limah

Mariana Armentano

Mariana Armentano

Mariana Becker

Mariana Becker

Mariana Cartier

Mariana Cartier

Mariana Ferrão

Mariana Ferrão

Mariana Godoy

Mariana Godoy

Mariana Leão

Mariana Leão

Mariana Milagre

Mariana Milagre

Mariana Paniz

Mariana Paniz

Mariana Sasso

Mariana Sasso

Mariana Weickert

Mariana Weickert

Marília Ruiz

Marília Ruiz

Marimoon

Marimoon

Marina Araújo

Marina Araújo

Marina Ferrari

Marina Ferrari

Marina Miralha

Marina Miralha

Marina Person

Marina Person

Marina Santa Helena

Marina Santa Helena

Marisa Silva

Marisa Silva

Marisy Idalino

Marisy Idalino

Maryeva Oliveira

Maryeva Oliveira

Merie Gervasio

Merie Gervasio

Mica Rocha

Mica Rocha

Michelle Giannella

Michelle Giannella

Michelle Loreto

Michelle Loreto

Milena Machado

Milena Machado

Milene Domingues

Milene Domingues

Mirella Cunha

Mirella Cunha

Mirian Bottan

Mirian Bottan

Monalisa Perrone

Monalisa Perrone

Mônica Apor

Mônica Apor

Mônica Fonseca

Mônica Fonseca

Monica Iozzi

Monica Iozzi

Mônica Veloso

Mônica Veloso

Mylena Ciribelli

Mylena Ciribelli

Nadja Haddad

Nadja Haddad

Natalia Ariede

Natalia Ariede

Natália Leite

Natália Leite

Natalie Gedra

Natalie Gedra

Nathalia Arcuri

Nathalia Arcuri

Nayara Caroliny

Nayara Caroliny

Neila Medeiros

Neila Medeiros

Nubia Rose

Nubia Rose

Paloma Tocci

Paloma Tocci

Paola Manfroi

Paola Manfroi

Patrícia Abravanel

Patrícia Abravanel

Patrícia Calderón

Patrícia Calderón

Patrícia Costa

Patrícia Costa

Patrícia Maldonado

Patrícia Maldonado

Patrícia Poeta

Patrícia Poeta

Paula Aliende

Paula Aliende

Paula Monteiro

Paula Monteiro

Paula Sack

Paula Sack

Paula Valdez

Paula Valdez

Pietra Príncipe e Luhanna Melloni

Pietra Príncipe e Luhanna Melloni - Multishow

Poliana Abritta

Poliana Abritta

Priscila Casagrande

Priscila Casagrande

Priscila Kirsner

Priscila Kirsner

Pryscilla Paiva

Pryscilla Paiva

Rachel Sheherazade

Rachel Sheherazade

Rafaella Brites

Rafaella Brites

Rafaela Tomasi

Rafaela Tomasi

Raquel Rocha

Raquel Rocha

Regiane Tápias

Regiane Tápias

Regina Volpato

Regina Volpato

Renata Capucci

Renata Capucci

Renata Fan

Renata Fan

Renata Freitas

Renata Freitas

Renata Longaray

Renata Longaray

Renata Maranhão

Renata Maranhão

Renata Pitanga

Renata Pitanga

Renata Vasconcellos

Renata Vasconcellos

Rita Lisauskas

Rita Lisauskas

Roberta Marques

Roberta Marques

Roberta Piza

Roberta Piza

Rosana Jatobá

Rosana Jatobá

Sabina Simonato

Sabina Simonato

Sabrina Coelho

Sabrina Coelho

Sabrina Parlatore

Sabrina Parlatore

Sabrina Sato

Sabrina Sato

Salcy Lima

Salcy Lima

Sancler Frantz

Sancler Frantz

Sandra Annenberg

Sandra Annenberg

Sandra Redivo

Sandra Redivo

Sarah Oliveira

Sarah Oliveira

Silvana Ramiro

Silvana Ramiro

Silvye Alves

Silvye Alves

Simone Garuti

Simone Garuti

Solange Frazão

Solange Frazão

Sônia Campos

Sônia Campos

Stella Gontijo

Stella Gontijo

Susan Germer

Susan Germer

Suzana Schott

Suzana Schott

Taina Vizan Figueroa

Taina Vizan Figueroa

Tatyana Jorge

Tatyana Jorge

Thaís Azze

Thaís Azze

Thaís Dias

Thaís Dias

Thaís Margarido

Thaís Margarido

Thalita Oliveira

Thalita Oliveira

Thays Beleze

Thays Beleze

Ticiana Villa Boas

Ticiana Villas Boas

Titi Müller

Titi Müller

Valéria Monteiro

Valéria Monteiro

Valquiria Melnik

Valquiria Melnik

Vanessa Cochi

Vanessa Cochi

Vanessa Faro

Vanessa Faro

Vanessa Libório

Vanessa Libório

Vera Viel

Vera Viel

Virgínia Nalon

Virgínia Nalon

Vivian Santos

Vivian Santos

Williane Rodrigues

Williane Rodrigues

Xuxa Meneghel

Xuxa Meneghel

Jornalistas mais bonitas do mundo:

Se escolher as jornalistas e apresentadoras mais bonitas do Brasil foi uma missão impossível, que dirá selecionar as mais belas do planeta, certo? Mas temos que tentar e foi isso que eu fiz. Veja a seleção das mais belas jornalistas do planeta!

Adriana Monsalve (Venezuela)

Alessandra Balletto (Itália)

Alina Moine (Argentina, mas trabalha no Equador)

Alina Moine

Arlett Fernández (México)

Ashley Russell (EUA)

Brenda Cavazos (México)

Carrie Milbank (EUA)

Charissa Thompson (EUA)

Charlotte Jackson (Inglaterra)

Erin Andrews (EUA)

Francesca Senette (Itália)

Georgie Thompson (Inglaterra)

Hazel Mae (Filipinas)

Heidi Watney (EUA)

Ilaria D’Amico (Itália)

Ines Sainz (México)

Jenn Brown (EUA)

Jennifer Sterger (EUA)

Jenny Scordamaglia (EUA)

Jenny Scordamaglia

Kirsty Gallacher (Escócia)

Kristen Berset (EUA)

Lara Álvarez (Espanha)

Lara Álvarez

Laura Lane (EUA)

Lindsay Soto (EUA)

Mayte Carranco (México)

Melanie Collins (EUA)

Melissa Stark (EUA)

Melissa Theuriau (França)

Mieke Buchan (Austrália)

Mirella Grisales (Colômbia)

Rula Jebreal (Palestina)

Sara Carbonero (Espanha)

Sophie Blake (Inglaterra)

Claudia Palacios (Colômbia)

Karolina Szostak (Polônia)

Karolina Sztovak

Tamara Ecclestone (Itália/Inglaterra)

Tamara Ecclestone

FOTOS: As fotos, em sua maioria, são de divulgação por parte das emissoras ou reproduções de imagens encontradas nos perfis de redes sociais das respectivas jornalistas e apresentadoras. Do contrário o crédito consta na própria imagem. Se algum autor identificar uma foto sua e não quiser ter o crédito incluído, basta avisar-nos que a mesma será imediatamente creditada ou removida, se assim desejado.

É isso. Curtiu nossa super lista com as mais belas jornalistas e apresentadoras de TV do Brasil e do mundo? Claro que existem centenas que merecem estar nesta lista. Por isso, mande sua sugestão!

  • Paulista

    MInha contribuição: Adriana Perroni, hoje na Globonews: http://jornalistaslindas.blogspot.com.br/2009/12/adriana-perroni.html

  • Rafael

    Pra mim a mais bonita é talita de oliveira da record.

  • nilton de souza

    lindas itapeba

  • Rogério Gomes

    coloca aí na lista:

    Veruska Donato
    Isly Viana
    Mônica Moraes
    Danielle Monteiro
    Fabiane Gadelha (do cidade alerta)
    Priscila assis

  • Victor

    Ô loco!,bah!,barbaridade!,brincadeira!,ô boi!,ô doido!,caraca!,caramba!,demais!,puxa!,puxa vida, nem sei mais o que falar!.

  • Marcelo

    Cadê a Samara Bastos do hoje em dia amigão! Ela estava em antes e agora não! Mais gata de todas!

  • Nivia

    A mais bonita é Nadja Haddad.

  • Marcelo

    mas vcs listaram todas as apresentadoras que há no Brasil, kkkkkkkkkkkkkkkkkk…..

  • Paulo

    Absurdo, faltou a mais bela de todas.. Daniela Boaventura

  • alexandro

    pesquisa furada pois a mais linda não esta na lista(Salcy Lima)

  • RODRIGO

    FALTOU A MARAVILOHSA CANDIDA OLIVEIRA DO BANDNEWS!!

  • Gloria de Castro

    Acho que faltaram as russas na relação das jornalistas estrangeiras. Aliás, nesta relação só tem americana siliconada: beleza zero…

    Faltaram muitas latinas lindas, mulheres do Leste Europeu e do Oriente também…

  • Alexandre

    Meu Deus… RENATA LONGARAY do Band News.

  • Contra silicone

    Era preferível ter só 30 do que encher a lista com bonecas infláveis, isto é, mulheres entupidas de silicone. Não vejo beleza nenhuma em seios com formato de esferas.

    • sergio cunha

      amigo, vc só pode estar doido deixando a camila bonfim fora desta lista. aliás, com tanta beleza forjada, é melhor mesmo que ela não esteja aí!

  • Japa

    Gabriela Mayer da TV Cultura é muito linda

  • Fernando Campos

    PARA MIM A MAIS LINDA DA TV BRASILEIRA E QUE DEVERIA ESTAR APRESENTANDO O FANTASTICO É ERIOKA REIS.tambem a FABIANA PANACHÃO FAZ MUITO O MEU GOSTO.

  • Felipe

    Amanda Couto linda!

  • diego

    faltou Cecilia Malan

  • Lucas

    Faltou Isabela Labate, repórter da Band.

    • Lucas

      Faltou a mulher mais bonita de minas. Carina Pereira -globoesporte/mg

  • João

    NÃO TEM A VIVIAN SANTOS?? A LISTA ESTÁ INCOMPLETA, MEU CARO.

    • Djacir

      Cristina Lyra, que mulher!

  • Pietro

    Faltou GABRIELA MAYER TV cultura

  • Anônimo

    Olá Rodrigo. Já postei alguns comentários neste blog, sugerindo nomes e tal como, por exemplo, as repórteres Fabiana do Nascimento e Denise Félix, ambas da RBS/SC. Hoje sugiro mais um nome: Heloísa Gomide, da Globo News. Acho ela gata. Se puder, exiba foto dela, ok? Abr.

  • Lucas

    Raquel Bellini é a mais linda!

    • Nelson Alcantara

      ADRIANA REID E A Melissa Theuriau (França) , Já tá de bão tamanho

  • RUBENS TEMPONI

    NÃO COLOCOU A JUKIANA VEIGA DA ESPN? A MAIS BONITA DE TODAS…..

    • nelson alcantara

      gg

  • T Carvalho

    Jackeline Petkovic

    • Nelson Alcantara

      Rapais essa Record deve fazer um concurso de Miss hein, só entra mulheres lindas , esses pastores .viu kkkkk

  • T Carvalho

    Procurem a jornalista Damaris Bubans da Record Brasília.
    Aliás a Record Brasília tem outras também.
    Venina Nunes….E a apresentadora,modelo,atriz,Gigi Monteirode SP.

  • Junior

    Vanessa Martins Marcela Pierotti Cristiane Amaral jornalistas de santos

  • marcos

    Pra mim sao todas lindas e maravilhosas e bem que podia me da uma..

  • Bruno Macedo

    merecido ter a minha querida de MG Maira Lemos da Globo Minas

  • Dilermando

    Fabiana Oliveira – Record MG
    Virgínia Nalon – Record MG
    Tainá Figuerôa – Record MG
    Ethel Corrêa – SBT Alterosa/ MG

  • chicoca

    faltou a Tatiane Brasil.

  • MONICA

    OI,

    NAO ACHEI A JAQUE SILVA DO VIDEO SHOW…. :)
    ELA É LINDA E SIMPATICA… MERECE ESTAR NESSA LISTA!

  • QUEM FALOU ? (MED)

    Pô amigos, tem muita mulher feia nesse meio aí ! Estão querendo fazer média dizendo que alguns "tribufús" são belas. Não vou nem revelar os nomes dos "tribufús" para não ficar mal, mas, tem muita "Mortiça" aí nessa lista.

  • LILI

    KALYNA SABINO E CAROL AGUAIDAS – SBT SÃO PAULO

  • LILI

    MÔNICA SIMÕES – REPÓRTER SBT SAO PAULO !!

  • LILI

    MÔNICA SIMÕES – SBT MANHÃ

  • wagner

    Maravilhosas!Sugiro a Priscila Brandão do Globo Rural.

  • Michel

    Faltou a Luciana liviero.

  • voliver

    Só faltou a belíssima Cecília Malan !!

    • walber freitas

      Concordo , faltou o rosto de Mona Lisa da bela Cecilia Malan.

    • Marcelo

      Cecília Malan não pode ficar de fora dessa lista. Ele é uma belíssima mulher!

      • renato

        mas ela está ali cara!!

  • voliver

    eiii , esqueceram a Cecilia Malan!!

  • Beto

    E a Hebe Camargos??rsrsr

  • Manfrei

    Faltou ou não vi a apresentadora do miami tv ? " Jenny Scordamaglia. ". Imperdível sempre com um vestido decotadíiiiiissimo !

  • Marcos Paulo

    Faltou a Mariana Milagre e principalmente Raquel Rocha, ambas da rede record minas.

  • César

    Bom dia,
    Pra MIM A GATA DO TODAS É MICHELLE LORETO.

  • AXL ROSE COVER

    Faltou as apresentadoras da ALLTV, como a Debora Rodrigues e a Susana Lima

  • Anônimo

    Grato pela inclusão de alguns nomes que indiquei. Porém, gostaria que colocasse também a Denise Félix, da RBS/SC. Ela também é muito gata!!!

    • http://curiosando.com.br/ Rodrigo Piva

      A Denise é linda mesmo, pena que não consigo foto, por isso não a add ainda. Mas assim que puder ela estará na lista.

      • Anônimo

        Ok. Obrigado pela consideração. Espero, então, publicação da foto de Denise Félix, gata da rbs/tv. Para ajudar, informo que ela é da regional de Itajaí. Faz reportagens em cidades catarinenses como Itajaí, Brusque, Balneário Camboriú, Itapema, Porto Belo… Envio, também, um link onde há uma foto dela. Espero ter ajudado. Abr.

        • http://curiosando.com.br/ Rodrigo Piva

          Ajudou sim. Eu até tinha visto essa foto, mas tentei encontrar outra maior. De qualquer forma, até localizar outra postei esta que sugeriu. Obrigado!!

          • Anônimo

            Ok, obrigado. Já vi a foto. Denise Félix é d+. Aguardo por outras fotos dela. Ela merece…

      • Rodrigo

        Cara, falta aí a jornalista Evelin Avancini da Cultura. Antes era da Globo. Gata d+++++++

  • Bulinário

    Chris Flores? Pelamordedeus!!! Muito feia pra estar aqui!!

    • luiz

      vc é maluco!

  • Daniel

    Falta incluir também: Letícia de Oliveira

  • Neto

    Favor incluir a Bárbara Martins, Maria Beltrão e Ana Carolina Abar.

    • Junior Mendonça

      Maria Beltrão não pode ficar fora dessa lista, concordo contigo

  • Casanova

    Sinceramente, esta lista deveria se chamar: "As 350 Jornalistas e Apresentadoras mais requisitadas da TV Brasileira", porque tem muita mulher aí de beleza somente comum e não belas. Numa lista onde constam: Carla Modena, Geovana Teles, Gloria Maria, Julia Petit e Maíra Lemos e dizer que essas mulheres são belas, é querer fazer média com as mesmas e para não parecer preconceituoso.

  • Anônimo

    Coloquem a Denise Félix (RBS/SC), por favor!!! Essa repórter é muuuuuuuuuuuuiiiiiiiiiiiiiitttttttttttttttoooooooooooooo gaaaaaaaaatttttttttaaaaaaaa!!!!!

  • Alan Lopes

    Faltou a Daiane Fardin da RPCTV – filiada da globo – aqui de Curitiba

    • http://twitter.com/driy_lima @driy_lima

      Verdade.

  • http://www.socompras.net Luiz

    Faltou também a Márcia Manfro.

  • http://www.socompras.net Luiz

    Faltou a Raquel Rocha da Record Minas Gerais.

  • Rafa

    Renata Fan, a mais linda e gostosa

  • Olemar Borges

    Por que não está aí a ANANDA APLE ???

    • Janjao

      Vixe…esse acabou de sair do xadrez…ta no queijo

  • Luciel

    ten as gauchas maira lessa e sabrina ongaratto rbstv e lucieli dornelles sptv

  • Alex

    Nesta semana eu vi a jornalista Mariana Palma na Globo em SP, ela é repórter do Bem Estar e está cobrindo o Salão Duas Rodas.
    Difícil achar foto dela mas ela aparece nos vídeos do Salão no G1. http://g1.globo.com/carros/assuntos/salao-duas-ro
    Segue a foto do Twitter: https://si0.twimg.com/profile_images/2267006795/i

    Belíssima.

  • Luc_8456

    Gostaria de sugerir ainda alguns nomes que vejo faltarem nessa belíssima coleção: Ana Paula Santos (do RJTV da Rede Globo), Ana Paula Mendes (do Inter TV Serra+Mar, jornalismo da Região Serrana do Rio de Janeiro), Cris Dias (do Globo Esporte) e Karina Monnerat (da TVC de Nova Friburgo).

  • CaetanoHenrique

    Falta incluir as jornalistas da RPC (Globo Curitiba) Ana Carolina Oleksy, faz a previsão do tempo no Paraná TV 1ª Edição (12:00 horas) e Claudia Celi ( faz previsão do tempo no Bom Dia Paraná (6:30 horas)

  • Joel Alves

    Faltaram a novidade Bruna Roma e Aurora Bello, além de Madeleine Alves e Valéria Grillo.

    A propósito, gostaria de saber o critério para definir jornalista: Tem que ter diploma ou atuar na área? Seja qual for, não entendo a inclusão de meras "celebridades" como Ana Hickmann e Luciana Gimenez. Nessa linha, vão considerar xuxa e ana maria braga também jornalistas (as minúsculas são propositais)

    Abraços!!!

    • http://curiosando.com.br/ Rodrigo Piva

      O título acho que deixa claro que a lista é de jornalistas e apresentadoras. :)

  • Anônimo

    Na minha opinião faltou também na lista outras três jornalistas: 1) Thaís Andrioli; 2) Denise Félix; 3) Sônia Campos; todas da RBSTV/SC. Coloca elas aí!!!!!

  • Claudio

    Debora Nigro, Sálua Zorkot… vou lembrando

  • Claudio

    opá; ainda esqueci, Soraya Lauand, Monize Poiani, Moniele Nogueira. Isabela Nascimento… afee, vou lembrando, vou mandando

  • Claudio

    faltou Aline MIdlej, Fernanda Bak, Gisele Gontijo, Roberta Marques e o q mais eu lembrar eu aviso… Abraço!!

  • lcmoretti

    Nessa lista faltou simplesmente a mais bonita e mais competente do brasil CRISTINA SERRA, essa é fera

  • Yan

    Eu tenho uma tara por Carol Barcellos !!!

  • Anônimo

    Falta a Carolina Bahia, RBS/SC, hoje correspondente da emissora em Brasília. Bota ela aí!!!

  • Gustavo

    A lista estava indo razoavelmente bem até que eu vi a Glória Maria. Tive que recuperar o fôlego das risadas para poder comentar aqui…

  • Anonimous

    Meu gosto é incomum xD
    Tem gente que olha pro corpo e fala que é bonita, tem outros que olham pro rosto e falam que é gostosa

    Eu destaco nessa lista:
    Andrea Bueno
    Bel Mouta
    Bianca Jhordão
    Carla Soraya
    Diana Bouth (PALMEIRENSE)
    Edieni Ferigollo
    Elaine Bast
    Eliana Marques
    Erica Reis
    Flávia Freire
    Gabriela Ferreira
    Gabriela França
    Glória Vanique***
    Jessica Biot
    Kalinka Schutel
    Lívia Raick
    Marina Ferrari
    Marisy Idalino
    Mirian Bottan****
    Monalisa Perrone
    Mônica Apor
    Mylena Ciribelli
    Nadja Haddad
    Patricia Sack
    E, CLARO, Karol Di Nassif e TUTA GUEDES (LINDA DEMAIS)

  • Chuck

    faltou Chuck Norris!

  • mg barros

    faltou a marcela araujo (sbt)!

  • Deco Santos

    Sinceramente achei uma falha as ausencias de Monalisa Perrone que tem uma beleza exótica e a Mariana Godoy que tem um jeitinho todo meigo

    • Vânia

      Mariana Godoy está na lista…

    • http://twitter.com/driy_lima @driy_lima

      A Monalisa Perrone certeza (:

  • Anônimo

    Entre as jornalistas já apontas neste site, uma que eu acho super gata é a Ana Paula Araújo. Ela já está na casa dos 40 e, mesmo assim, é bonita demais. O sorriso dela é lindo pois irradia muita luz, podem reparar.

  • Dilermando Lobo

    Faltou a bela Letícia Levy e a Flávia Alvarenga nessa lista.

  • http://twitter.com/CARIOCA_F1 @CARIOCA_F1

    Vocês estão malucos cadê a Gabriela Mayer Ex apresentadora do Hora News agora na Cultura o coloca a menina ai a lista de vcs esta faltando ela rsrs para o Obrigado mas coloca ela

  • Anônimo

    Brother, falta a Aurora Bello, do Sportv. Ela é muito gata!!!

  • Jônatas

    O que a Carla Modena, Glória Maria e a Geovana Teles Está fazendo neste site???

  • SÉRGIO

    FALTOU A TATIANA ESCOSTEGUY .

  • catia regina

    faltou a nossa querida Renata Seliprim, ela é lindíssima

  • Fã, apenas

    Karyn Bravo, Evelise Lais.. *—————————-*

  • Felipe

    Vai desculpar mas a lista é totalmente sem critério. Colocar qualquer nome que a galera manda também não dá né? peralá, Lorena Barbier tá na mesma lista de Renata Vasconcelos! ai tem alguma coisa errada!!

    • http://curiosando.com.br/ Rodrigo Piva

      A lista é dos leitores, não reflete meu gosto pessoal, senão tenha certeza de que ela seria bem diferente… hahahaha
      Mas ficou maior quando foi mesclado apresentadoras + jornalistas, por isso algumas polêmicas se formaram. É aquela história de tudo tem prós e contras. Mas saiba que compartilho sua opinião, Felipe! Abraços :)

      • Felipe

        Pois é Rodrigo, mas quando vc cria uma lista que tem o titulo de as + belas, se vc coloca qualquer uma q a turma envia ai deixa de ser de belas porque o gosto é subjetivo e passa ser uma lista de jornalistas de modo geral, não necessariamente as + belas. Acho que você podia dar uma filtrada pq no fim das contas foi vc q criou a lista ou troca o título. Vlw ae, desculpa a crítica, hehe. Abraços

        • http://curiosando.com.br/ Rodrigo Piva

          Imagina, críticas só ajudam. Sem elas a coisa desanda! hahaha

  • Remo

    Eu continuo a sugerir. Gisele Ramos, Ana Paula Gomes, Ruth Soares, Graziella Abrão, Lidia Duarte, Patricia Barros, Mara Pinheiro, Ana Paula Neves, Marcia Dantas, Ana Paula Oliveira.

  • Remo

    Tem mais outras jornalistas belas. Carolina Aguaidas, Simone Queiroz, Solange Boulos, Liane Borges, Manuela Queiroz, Lívia Braz, Venina Nunes, Denise Campos de Toledo, Alessandra de Castro, Luciana Marques, Luciana Machado, Vivian Santos,Renata Maia, Louise Cardoso, Maria Ferri, Claudia Martins, Cintia Assunção, Cintia Godoy, Vera Morgado, Marcela Morato, Iana Coimbra, Maressa Sousa, Debora Nascimento, Gioconda Brasil, Geiza Duarte, Helóisa Torres, Tatiana Nascimento, Paula Moraes, Thais Furlan, Renata Marques, Munyque Fernandes, Gabriela Mayer, Fernanda Sampaio, Kristine otaviano, Evelyn Avancini, Evelyn Bastos, Beatriz Pereira, Anne Beckhauser, Fernanda de Andrade, Ana Cristina Pimenta, Fernanda Penna. Tem muito mais que gostaria de ver entre estas beldades que vocês publicaram.

  • Remo

    Ainda falta muitas jornalistas belas. Juliana Perdigão, Simone Santos, Akemi Duarte, Fabiana Almeida, Viviane Possato, Luisa Torres, Maira Botelho, Natália Pereira, Maíra de Oliveira, Raquel Capanema, Ana Luisa Medici, Luciana Barreto, Aline Fonseca,Jaqueline Bogdezevicius,Aline Barcellos, Manuela Castro, Vivian Carvalho, Larissa Carvalho, Fabiana oliveira, Patricia Gomes, Shirley Barroso, Virginia Novick, Helen Oliveira e muitas outras.

  • Marcelo Fonseca

    Coloca aí as apresentradoras/repórteres da Rede Globo Nordeste: Maira Morais, Clarissa Góis, Gabriela Lisboa, e Wanessa Andrade.
    Da Tv Tribuna (afiliada Bandeirantes) – Júlia de Castro e Taís Cintra.
    Procure as fotos dessas. Você não irá se arrepender.

  • http://curiosanto matheus

    FALTOU tambem a jornalista da record de brasil renata varandas

  • Joel

    Glória Maria kkkkkkkkkk

  • Eduardo

    Maria Júlia Coutinho??? Rodrigo, por favor, dá uma revisada nessa lista!

  • /JJ

    cade a miriam leitão?….kkkkkkkkkkkkkkkkkkkkkkkkkkkkk

  • Pedro_25

    Uma dica aí…Ana Paula Abrão – RedeTV – Reporter do TV Fama e extinto Manhã Maior.
    Muito linda. Alta, coxas grossas, cintura alvantajada…Sempre bem vestida….Sortudo é quem casar com ela…

  • Manuela Borges

    A foto da repórter Manuela Borges está errada. Não sou eu!

    • http://curiosando.com.br/ Rodrigo Piva

      Obrigado pelo aviso, Manuela! Vou verificar imediatamente!!

  • Antonio

    São muitas as beldades, entre elas eu escolho Ticiana villas boas, camila bonfim, Patricia poeta, rosana jatobá, caroline lara e Gabriela de palhano.

  • Paolo Cesare

    A mais linda de todas elas é a Letícia Gil simplesmente maravilhosa!

  • André Ricardo Lima

    As que fizeram meu coração disparar. Minha lista top 10:
    1 – Jéssica Senra
    2- Marisy Idalino
    3- Carla Vilhena
    4- Jeniffer Cabello
    5- Carol Barcellos
    6- Erica Reis
    7- Paloma Tocci
    8- Gislaine Ferreira
    9- Caroline Castelo Branco
    10- Juliana Silveira

    Só gata !!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!

    • adriano

      E a musa do globo Esporte, A Lindona Cristiane

  • joãoluiz

    Quero foto de Michele Loreto,Marília Gabriela, Ana Furtado,e Glenda KOSLOVISK

    • joãoluiz

      Me lembrei da Renata Echeveria que trabalhou na globonordeste, por favor postar sua foto

  • Dino

    Faltou a Josiane da Ric Record-Joinville e a Evelise Lais da Record Joinville-marcela Verasquim da Record joinville

  • Matheus Romeiro

    Faltou nessa lista, a Barbara Coelho, reporter da Band Rio, e a Daniela Armentano, a moça do tempo do Jornal da Gazeta.

  • JUVENTINO

    Paloma Tocci é a coisa mais linda dsse planeta.

  • Helder Ferraz

    Faltou Ilze Scamparine

  • Marcos Souza

    Glória Maria na lista? Caramba, meu, essa mulher é HORRÌVEL!

  • joãoluiz

    Na minha opinião Renata Vasconcelos é linda, e com aquelas .pernas então.F alta Beatriz Castro,e Meire Lanunce de PERNAMBUCO.

    • joãoluiz

      A GRADEÇO PELAS FOTOS DE BEATRIZ CASTRO e Meire Lanunce que maravilha viva a globo nordeste

      • joãoluiz

        Ainda falta Márcia Peltier,Isabela scalabrini, Mariana Ferrão´,claudia molina ou abujanra,Lorena Barbier,Claudia CRUZ, Michele Loreto,Bianca Carvalho, e a bela ANA furtado que show.

    • joãoluiz

      Peço o favor de postar foto atualizada de FÁTIMA BERNARDES no programa mais você cada vez mais linda.

  • roberto

    A Rede Record, esta de parabens, todas lindas e competentes, roberta marques e natalia leite, sao apaixonantes, nao desmerecendo as demais, alem de algumas de outras emissoras que são um espetaculo a parte.

  • Edgar Fantin Barroso

    A seleção ta boa, mas faltou uma morenaça linda e deliciosa da TV Brasil, a boazuda Jeniffer cabello. tem umas pernas que me deixam doido. Mas no time ai a Palominha Tocci é a que mexe com meu coração kkkkkkkk… sou doido por ela!!!!!!!!!!

  • http://entremulheres.com/artigos/como-deixar-homem-louco enlouquecer um homem

    O Brasil é mesmo o país onde as mulheres são mais bonitas!! Grande seleção, qualquer uma delas deixaria um homem louco :)

  • gilsoncalima

    Keltryn Wendland
    Apresentadora do Jornal do Almoço de Lages-SC, na RBS TV/Globo.

  • marcinhomclaren

    Da EPTV a Elisandra Carelli ? Cade a Kelly Godoy e a Iara Ruffini?

  • http://www.evamar.com.br/ Evamar Lopes Caetano

    Concordo que faltou Juliana Junger GloboMinas.

  • vnd78

    Eliane Scardovelli…eu nao podia esquecer dessa DEUSA que não esta na relação acima…DELICIOSA

  • vnd78

    RENATA SAPORITO É ESPETACULAR
    Cristina Lyra EU TBM FICO SEM FOLEGO
    E PRA FECHAR A MARIA PAULA CARVALHO…BELÍSSIMAS

  • IsmaelCosta

    Só tem uma que me chama a atenção e não esta nessa lista, Leticia Gil, ô mulherão!!

  • keilon

    Cadê a Mõnica Teixeira – Globo Rio?

  • Luiz Antonio

    A Marina Araújo pode não ser a mais linda de todas, mas como é fofinha e simpática essa menina! O sorriso dela é 10.

  • Luiz Antonio

    Me desculpem todos, mas beleza e bom gosto são fundamentais. CLAUDIA BARTHEL é lindíssima. E não só produzida. Certa vez ela apareceu sem nenhuma maquiagem na sua apresentação, parecendo ter saída aquela hora da cama. LINDÍSSIMA!

  • Luiz Alberto

    Cadê a Eliana Marques da rede GLOBO???

    • http://www.curiosando.com.br/ Rodrigo Piva

      Devidamente adicionada.
      Obrigado pelo aviso!

  • Israel Scanferla

    PRA MIM A MAIS BELA JORNALISTA É A KÁTIA ASTROÉ SCANFERLA

  • Zeidon

    Fiquei encantado com essa loirinha (Emilim Schimitz) desde quando vi num site na qual leio. não foi atoa que mencionei ela para o curiosando? agora na FOX SPORTS posso vê-la todos os dias.

  • JAN MOREIRA DA SILVA

    PARA MIM, MAIS LINDA, ELEGANTE, CHARMOSA E PROFISSIONAL QUE CAMILA BOMFIM AINDA NÃO CONSEGUI VERIFICAR. UM DOS MOTIVOS QUE ACOMPANHO O JORNAL NACIONAL É VER AQUELA ESTRELA BRILHANDO EM SUA ÁREA NAS REPORTAGENS AO VIVO. NÃO ESTOU EXAGERANDO. CAMILA BONFIM É DE PARAR O QUE ESTÁ FAZENDO E VISUALIZAR A TV. SE ESTIVER JANTANDO, CUIDADO PARA NÃO ENGASGAR. ELA É LINDA DEMAIS.

  • bruno

    faltou a Renata fan e a kelly pedrita q na minha opinião é a mais bela do brasil a kelly ja foi eleita miss mundo paraná foi tbm terceiro lugar no miss mundo brasil 2007 foi rainha do café,foi miss top model brasil of the world,e venceu o maior concursos de modelos do mundo o miss model of world,miss américa fotogenia e hj ela é reporter do jogo aberto.

  • Jblas

    Faltou a bela Érica Reis do Band News

  • José Carlos

    Muito bom. Senti falta da CAroline Nogueira. Dá prá acrescentar???

  • Gabriel

    Faltou a Fernanda Cezaroni (Rede Vanguarda Vale do Paraíba – SP)

  • Leo775

    Cara….. parabéns…..
    Excelente .. imagino o trabalho para localizar as fotos de todas essas divas e coloca-las aqui !!!!
    Muitas do Rio Grande do Sul, especificamente na metade sul……!!!
    Abraçãoooooo

  • R. Oliveiras

    Rodrigo, você está de parabéns! Eu pensava em reunir fotos de belas jornalistas, mas você já fez isso com uma quantidade muito maior de mulheres do que eu idealizava. Contrariando o estereótipo a que estamos (mal) acostumados, estas são mulheres bonitas e inteligentes. Agora, o difícil é saber qual é mais bonita.
    Sugiro que seja informado também a qual tv de qual cidade pertencem as belas. Ex: Ana Paula Padrão, TV Record, São Paulo, SP.

  • http://twitter.com/Vagnao101 @Vagnao101

    faltou debora menezes

  • SERGIO

    Sergio: faltou CAROLINA ROMÃO (RIT TV ) e LILIAN COELHO (TV CAMARA

  • TopMan

    Nessas listas faltou uma jornalista muito linda e charmosa que é a Joyce Hasselmann do Paraná no Ar, RICTV Curitiba. E também faltou a Adriana Consoli também da RICTV Curitiba.

    • TopMan

      E também sugiro a super gata Kátia Scanferla (RICTV Curitiba).

  • Iago Bandeirante

    Gabriela Ferreira da Band Rio e Lívia Raick do SBT Rio.

    Essas duas são gostosas, hein! Kkk.

  • Alex

    Além das que estão na lista gosto também da Maria Paula Carvalho. Ela apresentava o Via Brasil e agora está na Globo News.

  • alexandre

    cadê a reporter Patricia Ferraz, da Rede Record, São Paulo

    • http://www.curiosando.com.br/ Rodrigo Piva

      Ela já está no post. Aparece antes da Patrícia Maldonado, dê uma olhada.
      Abs

  • luis da silva

    grande maioria lindas lindissimas q tal incluir a bianca carvalho eptv campinas .

  • adao

    so faltou a lilia teles da tv anhaguera de goiás

  • David Costa

    Faltou a Sophia Reis da A Liga da Band .

  • Serginho

    Se a Juliana Rosa usasse sutiã menor daria um up!! Gata

    • Paulo

      Concordo Serginho!
      Que busto!!!
      Ela e a Cristiane Pelajo são as melhores!!
      Abaixo ao decote!!

  • jean carlos

    sinseramente deveria ter dado mais atenção à Renata Vasconcelos,pois
    ela está entre as melhores e tambem faltou a katiuscia neri que é uma
    delicia e gata.

    • Francisco Matos

      Pra mim são todas bonitas e gostosas

  • bobjulianoporto

    pra variar as mineiras são as mais lindas

  • Renato

    Faltou a minha xará, a Renata Ceribelli…nossa, aquela mulher é um tesãooooooooo
    Faltou também a Luciana Ávila…muito gostosa

    • perseu

      ceribelli ta ai sim fiote!

  • nardo

    Giuliana girardi

    kd

    ela????

    • perseu

      ta ai uai, verifica la
      ta linda como sempre

  • JOSÉ RICARDO

    É DIFÍCIL DIZER QUAL A MAIS BELA. TEM UMAS 10 PELO MENOS QUE EMPATAM. AINDA ACHO QUE FALTOU A LILIANA JUNGER DE B.H. É SHOW DE BOLA TAMBÉM!

  • José Davi-CE

    Pra mim, faltou pelo menos 4 nessa lista: Leticia Gil-record (que bundão ela tem, GOSTOSSÍSSIMA), Ana Claudia Andrade-tv cidade fortaleza (loirinha show de bola, muito simpatica e bonita), Danielle Portela-tv verdes mares fortaleza (baixinha gostosa) e Adriana Dias-tv jangadeiro (tem uns olhos verdes que matam. O loirinha show. Pena que agora só é reporter). (não sei se pode. Mas colocaria tambem Amanda Estanislau-tv cidade fortaleza e Vera Viel-record news. Mas essas 2 não são jornalistas). Muito boa a lista, só gatas (com exceção de umas 2 ou 3 como a fatima bernardes). Show de bola.

  • http://xxxx ailton jose ferreira

    sou fan da reporte quer faz tudo aver da rede recour

  • Edmundo Menezes

    todas são lindissima mais faltou a loirissima Camila Maravilhowisk

  • justino

    faltou a leilane neubarth da globo news

    • Vânia

      Ela está aí na lista…

  • Joao souza

    Cade caroline Hasselmann belissima!

  • joaquim gilberto heg

    A mais linda fautou, Paola Manfroi da RPC

  • Edu

    Coloca aí na lista a morena de olhos verdes da RIC aqui do Paraná a Valquiria Melnik.

    • perseu

      a penultima é ela mermao

  • tiago santos monteir

    cade a leticia gil é a mais gata de todas

    • Casanova

      Se voce olhar a lista até o fim e prestar mais a atenção, irá encontrar a Letícia Gil aí nessa lista.

  • Olemar Borges

    O olhar da Roberta Marques me derrete.

  • PAULO ROBERTO

    GOSTARIA Q SE POSSIVEL INCLUISSE NAS FOTOS DAS JORNALISTAS + BELAS DO BRASIL, AS FOTOS DEGEOVANNA TELES, POLIANA ABRITA E FLAVIA ALVARENGA AMBAS DA TV GLOBO DE BRASILIA

  • Olemar Borges

    Érica Reis – 10

    Carol Guedes – 10

    Cristina Lyra – 10

    Mariana Ferrão – 10

    Milena Machado – 10

    Roberta Marques – 10

    Ticiana Vilas Boas – 10

    Carol Barcellos – 10

    Luíza Zancheta – 10

    Poliana Abrita – 10

    Simone Garuti – 10

    Tina Roma – 1000000000000000000000

    • joao Barros

      Caroline Hasselmann- 10

  • Olemar Borges

    Tina Roma, se juntar a beleza de todas as outras, não chega à metade da lindeza dela.

    Tiiiiiinaaaaaaaaaaaa!

  • Olemar Borges

    A TINA ROMA jogaria com a camisa 10 no meu time. Tina case comigo! Por favor!

  • Olemar Borges

    Eu largaria tudo pra ir embora com a Tina Roma.

  • robson james

    as mais lindas na minha opinião é Renata Vasconcelos que é uma gata linda eu chego ate sonhar com ela e em 2° vem patricia costa da record e Ciane neno da bandeirante (RBA) Belem

  • http://parabens ricardo

    o time da record, neste requesito é campeão, so tem fera, alem de lindas são inteligentes, na minha opinião, Roberta Marques, simplesmente linda, sou seu fã n. 1, acreditem.

  • Nézio

    Espetáculo essa lista de mulheres lindas, mas tenho nomes que não estão e são lindas tambem, la vai: Cristina Ranzolin, Cristiane Silva, Daniela Ongarati, todas da RBS TV.

  • Ramiro

    A Thatiana Brasil da Record é simplesmente maravilhosa.

  • Nacim Sfier J&uacute

    Faltou nesta lista o nome da Giselle Camargo, da RPC, que demonstra simpatia e uma beleza estética muito linda.

  • Feniano

    Porque Esqueceram a Ruiva Deliciosa e competente Milf Leilane Neubarth ????!!!!

  • eduardo

    essa mariana becker parece um ex halterofilista da alemanha oriental. cade a renata fan?

  • alex

    só deusas lindas…..d+ isso.

  • ana

    a priscola casagrande e muito talentosa eu gosto muito dela ! um beijo enorme para voce priscila ! voce e linda !!!! bjs !!!!!!!!

  • thyago souza

    Posso afirma, que nesse país não tem mutivo de vever na solidão! Para todas vocês parabens, são nossa razão de vida.

  • jorge pinto de almei

    KD A SILVIA BARTELL DO LEITURA DINAMICA DA REDE TV?!!!!

  • Adilnar Sereguello

    Discordo do WALTER que em janeiro disse que as apresentadoras morenas passam mais seriedade na notìcia.

    As notícias em sua maioria já são tão pesadas que o que precisa mesmo é de um ar de leveza então a mim não importa a aparência da moça e sim o seu preparo profissional, sua ética e o seu compromisso com a verdade e eu como professor da área me permito opinar com propriedade.

  • Antônio Isidor

    A mais bela apresentadora e competente tambèm é sem dúvida a Adriana Reid; profissionalíssima e muito bonita!

  • Paty B

    Algumas são realmente lindas, mas vamos combinar que algumas entraram por simpatia ou apenas para terminar a lista!!!

  • Thais

    Naõ é por ser minha irmã, ela é linda e agora esta na RIC TV Curitiba. quer ve-la ela esta no YouTube CAROLINE HASSELMAN

  • Rita de Cassia

    Faltou Caroline Hasselmann ex Record Salvador ela agora esta RIC TV Curitiba ela e'muito bonita!

  • randra Morais

    Faltou Caroline Hasselmann Ex record Salvador e agora esta na RIC TV em Curitiba ela e'muito bonita!

  • Marcio

    Gislaine ferreira Globo minas

  • ilton rebello filho

    kellly godoy eptv afiada globo sao carlos sp que baixinha maravilhosa

  • Ronaldo

    faltaram as meninas da TV GAZETA do ES, que colocam, muitas destas ai no bolso…., Poliana Alvarenga, Tati Braga, Rafaela Marquezine….e por ai vai….um abraço

  • ANDRÉA KRAUSS R.LOBO

    Que legal minha sobrinha ( Carol Guedes) LINDISSIMA e minha prima Leniza Krauss ( Linda, parece tanto com minha mãe). São maravilhosas tanto em beleza quanto em profissionalismo……………

  • Raul

    A Mônica Apor não é Jornalista. E mesmo que fosse não é bonita, ela tem a boca torta

  • Anônimo

    Concordo, totalmente, com algumas jornalistas selecionadas: Ana Paula Araújo, Milena Machado, Paloma Tocci, Lidiane Sayuri, Patrícia Poeta, Rosana Jatobá… Não concordo com outras repórteres selecionadas, mas, enfim… Entretanto, na minha opinião, faltou, pelo menos, mais uma: Giovanna Teles. Acho ela gata demais. Insiram-na na lista, ok? Obrigado.

  • http://twitter.com/sirJorgeLuis @sirJorgeLuis

    Além da Louise Calegari a qual já foi citada, indico a também baiana a bela da manhã: Jéssica Senra da Rede Record Bahia, segue o link da imagem: http://a0.twimg.com/profile_images/1548466716/twi

  • master

    Pow cade a mirian leitao !!$%$%@$@$!……..

  • Ricardo

    eu quero sugerir a Giselle Camargo. A mulher é um arraso! como posso mandar uma foto dela?

  • http://www.curiosando.com.br Apaixonado

    Fernanda Gentil, Renata Fan e Paloma Tocci S2 S2 S2

  • José Padilha

    …E la vai o meu time: Roberta Marque, Renata Fan, ágda Queiroz, Thalita Oliveira, Amanda Françozo, Carol minhoto, Ticiana Vilas Boas, Carla Cecato, Lidiane Sayuri, Fabiana Panachão, Nadja Hadadd, Patrícia Poeta, Andressa Wolf, Brenda Parmagianni, Carla fachim, Cláudia reis, Izabela Camargo, Michelle Gianella, Nathalia Guimarães, Milena Machado e Claudia Bartel – Qerem mais? Tenho anotado ainda o segundo e o terceiro time, e com um pouquinho de boa vontade faço mole mole o quarto time – Abração em todos.

  • José Padilha

    Pra mim a mais gata é: Roberta Marques.

  • Marco Antonio

    Thais Furlan (Record Londres)
    Beleza Clássica.

  • valter

    a agda queiroz e a mais linda de todas

  • paulo

    Paloma Tocci a gostosa da rede tv e melhor de tudo solteira essa sim só ta faltando sair na playboy….

  • Luizão Batera

    Faltou a Bianca Rothier, linda e com sua maravilhosa comissão de frente.

  • sergio lopes

    faltou a silvia popovich tenho um enorme tezao por ela

  • Luiz Otavio Silva

    Ola

    Boa Tarde

    Fico muito feliz por ser paraense e de ter encontrado uma jornalista entre as mais bonitas do brasil VANESSA LIBORIO/RECORD BELEM.

    Parabens pela iniciativa do site mas voces deveriam incluir tambem a jornalista CARLA ALBUQUERQUE/TV LIBERAL BELEM.

    Atenciosamente;

    Otavio Silva

  • Paulinho Ferreira

    Com certeza podem acrescentar Jessica Leão : confiram e me digam se não estou certo. As duas apresentam programas no Cnal Net Cidade de Mogi das Cruzes
    Vlw

  • Paulinho Ferreira

    Com certeza podem acrescentar Jessica Leão : confiram e me digam se não estou certo. <a href="http://www.megashopmogi.com.br” target=”_blank”>www.megashopmogi.com.br

  • Lucas

    Esqueceram da Aurora Bello,do Sportv!

  • AGNALDO

    Em meio a tantas mulheres lindas, ainda falta minha apresentadora e repórter
    favorita e linda. LARA MOTA, ric tv, programa BALANÇO GERAL E JORNAL DA RECORD PR,
    E AGORA REPORTER DO PROGRAMA HOJE EM NA RIC MESMO.

  • Alessandro

    Muito bom, mais algumas, Karine Garcia (RPC Paraná) e Vanessa Rumor (RPC).

  • Joel Alves

    Faltou a Silvia Damasceno. A propósito, por onde ela anda?

  • Alessandro Zanettini

    Faltaram algumas ai, vai lá: Luciana Magalhães (Gazeta); Carolina Romão (RIT TV); Agda Queiroz (Record).

  • Marcelo

    Faltou a Renata Saporito do BandSports. Filézinho.. muito gata.

  • moacyr dasartes

    apaixonante esta renata

  • Um Sonho!

    Mariana Leão é Tudo!!! Ai se eu te pego….!

  • monique

    mariana ferrao conseteza e a maisssssssssssss limda!!@!@!@!

  • wallace

    Parabéns pela lista!
    Renata Maranhão é um espetáculo!

  • rick

    juliana rosa/globonews

  • Marco Antonio

    PARA SER ACRESCENTADO: (sem falta)
    Claudia Barthel (Rede TV)
    Marina Person
    Regiane Tápias (Gazeta)
    Carol Minhoto (Gazeta)
    Stella Gontijo (Gazeta)
    Regina Volpato (Rede TV)
    Priscylla Paiva (Record News Tempo)
    Roberta Marques (Record News)
    Amanda Françozo (Record News)
    Mônica Iozzi (CQC)
    Lorena Calábria
    Mônica Veloso (SBT)
    Patrícia Costa (Record / Record News)

  • Felippo

    Luiza Zanchetta, Priscila Casagrande,

  • ANINHA

    Só aparece as jornalistas da tv e as de redação e assessoras?

    • http://www.curiosando.com.br/ Rodrigo Piva

      A ideia inicial era apenas as jornalistas de TV por obviamente ser bem mais fácil de selecionar, mas nada impede que sejam incluídas as belas das redações. O céu é o limite. Se quiser já pode deixar aqui suas indicadas. :-)

  • Claudio

    Tenho uma sugestão: Mayara Martins, do SBT da região de Campinas SP (salvo engano). Pode conferir. É pura Beleza.

  • Alex

    Tá faltando nesta lista a Fabiana Panachão, da Record News, ela é muito linda.

  • Maykon

    Mariana Becker da Formula 1. E outra, se tem Carla Vilhena e Sandra Anenberg, pode ter a Fátima Bernardes também, ne?

  • Felippo

    Heleine Hering

  • Filippo

    Daniela Salerno, Daisa Belini, Cristina Scaff, Vanessa Libório, Camila Busnello,
    Leniza Krauss, Adriana Bittar, Cristiana Gomes, Flavia Scalzo, Louise Calegari,
    Ingrid Griebel, Juliana Alvarenga, Mylena Ciribeli …

  • http://@jocafilho2 José Carlos

    Poxa sem palavras huauuuuu!!!!

  • William Marques

    PAULA VALDEZ – RBS TV (AFILIADA REDE GLOBO RS)
    ALICE BASTOS NEVES – RBS TV
    DÉBORA DE OLIVEIRA – RBS TV
    THAYNAH ESPINOZA – BAND RS
    PAULA MENEZES – BAND RS
    DANIELA FREITAS – BAND SP OU RJ SEI LÁ

  • http://mofonovo.blogspot.com neri

    Nadja Haddad da Band (vcs erraram o nome na legenda da foto) bate de longe nas concorrentes

  • José Murilo

    Pra mim, a Natalie Gedra (Band) já venceu esta lista. Natalie Gedra é a repórter mais bonita do momento.

  • Felippo

    faltou a, Patricia Ferraz, Manuela Borges, Andrea Beron, Cleisla Garcia, Merie Gervásio, Lorena Coutinho,
    Thatiana Brasil, Denise Odorissi …

    • Felippo

      Leticia Gil, Venina Nunes, Janine Borba

  • Daniel Souza

    Eu sugiro a Juliana Verboonen do Gazeta News e do Tempo do Jornal da Gazeta é a mais linda na minha opnião alem de muito simpatica.

    E a Luciana Camargo também do Jornal da Gazeta.

  • Frank Cesar

    OI CECILIA FLESH TUDO BEM!

    IREI DIZER ALGO A VOCÊ ,QUE AOS OLHOS E PENSAMENTO DE OUTRAS PESSOAS ACHARIAM LOUCURA O QUE DIREI A VOCÊ

    E AO PÚBLICO QUE TE ASSISTE!

    EU PREFIRO OUVIR O SEU SIMPÁTICO SOLUÇO

    DO QUE OUVIR MUITAS BOBAGENS !

    QUE ALGUNS APRESENTADORES NOTICIAM POR AÍ!

    CLICK
    http://www.youtube.com/watch?v=6zX0SFrSVeQ&NR

    PRA VOCÊ CECILIA FLESH

    CLICK E OUVE CECILIA FLESH
    http://www.youtube.com/watch?v=rWE9Vl6caR8&fe

    Rostos E Aeroportos

    Camisa de Vênus

    Vou vestir a minha sombra

    Preciso me proteger

    Eu sempre manejei bem as palavras

    Mas agora não sei o que dizer

    Sua voz tão calma e fria

    Penetrou tão lentamente

    Congelou o meu orgulho

    Embaçou a minha mente

    Vejo seu rosto nos aeroportos

    Nas ruas, nos cinemas, nos jornais

    Vejo seus olhos nos faróis de meu carro

    A noite eles sempre brilham mais

    CLICK PARA OUVIR
    http://www.youtube.com/watch?v=d0I6SMS-oqA

    Todas As Canções

    Virtud

    Sei que o Teu Amor não mudou,

    Mesmo depois dos meus erros.

    E a Tua mão está sobre mim pra me guiar,

    Cada dia vou viver pra Te louvar

    Pra te adorar, enquanto eu respirar

    Todas as canções do universo

    Não irão dizer o que eu sinto

    Mas espero que os meus versos

    Possam agradar Teus ouvidos

    Todas as canções do universo

    Não irão mostrar o que eu sinto

    Mas espero que os meus versos

    Possam alcançar o infinito

    Hoje estou aqui pra dizer,

    Que a minha voz não é nada

    Sem a unção que está sobre mim,

    Pra me guiar

    Cada dia vou viver pra te louvar

    Pra te adorar, enquanto eu respirar

    Todas as canções do universo

    Não irão dizer o que eu sinto

    Mas espero que os meus versos

    Possam agradar Teus ouvidos

    Todas as canções do universo

    Não irão mostrar o que eu sinto

    Mas espero que os meus versos

    Possam alcançar o infinito

    • Frank Cesar

      EU NÃO DIRIA QUE A MESTRA EXTRAORDINÁRIA

      ELAINE BAST

      É UMA MULHER LINDA DE MORRER ,

      MAS COMO BEM MELHOR

      DIZENDO ENTRE TODAS ESSAS MODELOS

      A DIFERENÇA ENTRE ESSA MOÇAS

      A MESTRA EXTRAORDINÁRIA ELAINE BAST

      ELA É MUITO INTELIGENTE

      ELA ME DÁA ,PRA MIM

      ISTO QUE É BELEZA EM UMA MULHER

  • Rosalvo Rosa

    Tá faltando muita gente nessa lista. Uma delas, a Camila Bonfim.

  • caio

    Falta a Andresa Guaraná, da TV Bandeirantes na lista 1. Ela eh muito gata, deusa. Ja vi ao vivo. Eh muito gostosa.

    • Romarlo Marcassi

      Thays Beleze é a mais linda, mais charme Thays Beleze é tudo de bom.

  • Claudemir Cassiano

    Conconrdo com o Marco Antonio e acrescento a Jaqueline Brasil da Rede Globo (Radar SP).

    Gata….

  • http://r7.com Vanderlei

    A Agda Queiroz é uma deusa da beleza, essa mulher é damais…

    todas mencionadas acima são belas, mas a Agda falta-me comentarios sobre sua beleza, simplesmente damais…

  • jones

    tbm faltou diana rocha record rio de janeiro

  • Zeidon

    Interessante essa do Thiago Liefert, sou mais a Emilim Schmitz, mais essa loirinha dos pampas e do Liefert e gostosa.

  • ERICK CAVALCANTE

    A DAIANA GARBIN GANHA DE TODAS ELA E A MAIS LINDA, NAO E A TOA QUE O TIAGO LEIFERT ESTA NAMORANDO ELA.

  • zeidon

    Essa lista tá interessante, mas vocês esqueceram de colocar três jornalistas de Santa Catarina:Camille Reis, Laine Valgas e aquela loirinha show de bola, chamada Emilim Schmitz, e um pouco parecida com a Ellen Rocche.

  • Cezar

    A lista tá boa, mas num é só as mais belas, tem todas as jornalistas conhecidas.

  • lucash

    fernanda gentil nao eh mais mais bonita…mais eh coisa lindiiia!

  • Marco Antonio

    Thalita Oliveira (Record)

    Bota Aí!!!

  • Marco Antonio

    Essa Também vale a pena:

    Claudia Tenório (Rede Vida)

  • Marco Antonio

    Sugiro encrementar esta lista com as presenças de:

    Carla Cecato (Record)

    Roberta Piza (Record)

    Patrícia Costa (Record)Tempo

    AnaLice Nicolau (SBT)

    Chris Flores (Record)

  • celso

    MARINA FERRARI DA BAND

  • DUDU COSTA

    Acho que voces não gostam das "Natalias" A Natalia Leite chega a abusar de ser bonita. E a Natalia Guimarães então ? ah ah ?

  • flavio

    não esqueça de jackeline brazil , radio sulamenrica transito e sptv

    belissima

  • Bill

    Marilia Ruiz??? nada a ver, faltou ai a Mariana Godoy

  • CARLOS MENEZES

    TODAS SÃO LINDAS !!!

  • http://www.vinidesigner.com.br Vinicius Silva

    Essa Daiana Garbin é linda. Estou apaixonado. *_*

  • Paulo Solon

    A Gabriela de Palhano é uma gata. Ela comecou a carreira aqui em Fortaleza e hj esta em Sao Paulo. Outra muito bonita tb eh a Mariana Sasso, da Tv verdes Mares.

  • Gino

    Quem um dia faou que mulher bonita é mulher burra, errou totalmente, e a prova são essas lindas e inteligentes mulheres da nossa televisão.

    Parabéns pela homenagem a elas.

  • Curiosidade

    Carla Soraya da Tv Diário de Fortaleza

  • Celso Regis

    Esta lista é muito bonita mas nem precisava enfatizar como as mais lindas. Afinal. todas são lindíssimas. Fou uma delícia vê-las reunidas. Grande idéia.

  • http://www.bonuseapostas.com Apostas Online

    adorei Luize Altenhofen :D

  • Eu

    Thays Beleze (PR)

    Renata Maranhäo

    Poliana Abritta

    Luciana Avila

    Carla Fachim (RS)

  • RafaH

    Vou Destacar 3 em duas listas pq tem algumas mulheres ai que são mais pra modelos isso sim.

    Jornalistas :

    1_Cynthia Benini(Além de linda mto carismatica)

    2_Renata Maranhão(Sem comentarios *-* )

    3_Ana Paula Padrão(Uma beleza classica ao meu ver)

    Jornalismo Esportivo:

    1_Ana Luiza Castro (Que par de olhos azuis são aqueles OMG???)

    2_Renata Fan (Simplismente miss Brasil 1999)

    3_Luize Altenhofen (Beleza Americana.)

  • Incógnita

    Nossa, tem uma muito linda,no ''Tudo a ver'' da Record,mas esqueci o sobrenome dela.O nome dela é Nathália/Natália.Não sei se é a Arcuri,mas a Arcuri não é do Tudo a ver (acho).Mas a Nathália Arcuri a mais linda dai,na minha opinião. (:

  • Estilo Namorador

    Essa IZABELA CAMARGO é linda ate sem maquiagem.

  • Malk

    Cadê as gostosas da Mônica Waldvogel, Lilian Wite Fibe e Marilia Gabriela?

  • artur Barz

    Tem uma ancora aki de Santa catarina q eh bem gostosa…Acho q apresenta a revista santa catarina aos domingos…Porra, ela humilha muita modelo, pqp…

  • iED

    Outra vez esqueçeram da Williane Rodrigues do SBT! Ò__ó

  • http://saudedehomem.blogspot.com/ Pablo

    Muito bom o seu blog, ja estou seguindo.

    Segue o meu tbm: http://saudedehomem.blogspot.com/

    Parceria? Adicione: saudedehomem@hotmail.com no MSN para conversarmos.

  • http://www.garimpoweb.com José Carlos

    Gostei do Post!

    Conheça o agregador http://www.garimpoweb.com

    Divulgue seus links!

    Milhares de visitas diarias.

  • Victor

    A Tatiana Chiari da Rede Record também é muito gata.

  • Marcelo Eliel

    Glenda Kozlowski ?? só pode ser brincadera … ¬¬

  • felipe

    a maais linda é a chris dias, mas a débora vilalba é maravilhosa demais tb =)

  • Anonimo

    AFew, as mais bonitas? tem mmt gata ai, mas tem umas que exageraram, pq nao poe tb a mulher do willian bonner ja que é pra esculaxar…afew…

  • Paulo Cesar gotijo

    Faltou a Elisangela Carreira da Band Interior.

  • #ficadica

    Faltou a Nathalia Arcuri, que foi até cantada pelo Jon Bonjovi durante entrevista!

    http://noticias.r7.com/videos/jon-bon-jovi-paquer

  • Cdr

    Falto a mais linda de todas: Thays Beleze da RPC TV: segue a foto http://1.bp.blogspot.com/_v7DVMJbjHEM/TM4Z2B1oPKI

  • fernanda

    Gostei do Post! Já pensou em divulgar também no http://www.plik.com.br ?

  • http://www.myspace.com/cadelis Cadelis

    Karine Garcia da RPC (Paraná). Pena q nao esta na lista, na minha opiniao uma das mulheres mais belas da Tv Brasileira…

  • Victor

    Faltou a Sabina Simonato, repórter do SP-TV (rede Globo)

  • AnonimodoRJ

    Monica Apor humilha todas!!!

  • Pablo

    Fabiane Kaczan é PERFEITA, gata demais e ainda quase ganhou 1 milhão no 1 contra 100

  • Leonardo

    Eu quero saber aonde esta a Gisele Ishida da Band News??????!!!!!!

    A apresentadora oriental mais bonita da tv brasileira!!!!

  • Rone Brito

    Fernanda Gentil do sportv

    Patricia Chueri da Band

  • http://gentedemidia.blogspot.com Nonato Albuquerque

    Fabiane Kaczan, apresentadora do Esporte Jangadeiro na TV Jangadeiro de Fortaleza não fica nada a dever a essa (excelente) lista.

  • Fera

    faltou também a Adga Queiroz, linda!!!!

    http://www.papodebola.com.br/24horas/beladodia/ag

  • JUNIOR

    VOCE ESQUECEU A ANA LUIZA GUIMARÃES E A RENATA CAPUCCI DA GLOBO, QUE SÃO BELÍSSIMAS!!

  • Ðαη&io

    As mais lindas são: FLÁVIA FREIRE e DÉBORA VILALBA

    Casaria com qualquer uma das duas!

  • steve vai

    onde está a Poliana Abritta???????????????????????

  • daniel

    marilia ruiz cara, ta de brincadeira

  • Gustavo

    vocês não assistem ao jornal Hoje da globo não?

  • Rafa

    Renatas… Maranhão e Vasconcelos.

    Espetáculo.

    Tem duas loiras na Globo de SP que são lindas tbm, Diana Garbim e Natalia Ariede.

  • Walter

    Só gatas, as morenas acho que são maioria, passam um ar mais sério a notícia.

  • http://chamaobarman.blogspot.com/ @Bruno_Barman

    Boa a lista, só faltou a Cindy Harada do Band Sportes e a Cristiane Pelajo do Jornal da Globo.

  • Zaca

    Faltou a mais linda de todas. Carol Barcelos, do RJ

  • http://grupoganapati.blogspot.com/ PedroPK

    Faltou a melhor!

    Poliana Abritta:
    http://oglobo.globo.com/blogs/arquivos_upload/200

  • http://www.webprincipiante.com/ Rafael Avelino

    A paloma Tocci e a Michele do gazeta Esportiva são gatissimas!!!rs

  • http://entremundos.com.br/ Gabriel Meissner

    A melhor na minha opinião é a Patrícia Poeta! Gata!