+350 Jornalistas e Apresentadoras mais belas do Brasil e do Mundo

Por  |  293 Comentários

Atualizado em 17 de maio de 2014 | Quando resolvi criar uma lista que reunisse as mais belas jornalistas da TV, não imaginei o sucesso que seria. Começou com cerca de 30 nomes, pois apesar de vivermos num país imenso, fiquei restrito à emissoras com alcance nacional. Aí me mudei para a baixada santista e conheci novos nomes, de emissoras da região. Em pouquíssimo tempo passei a receber comentários e e-mails com sugestões de nomes das mais diversas emissoras locais espalhadas pelo Brasil.

Atendi também uma sugestão para abrir o leque e incluir apresentadoras. O resultado está aqui: mais de 350 lindas jornalistas a apresentadoras da TV brasileira.

Óbvio, seria muita pretensão querer que TODAS estivessem aqui. Quase impossível; ou talvez nem tanto. Conto, ou melhor, continuo a contar com a sua sugestão para que esta lista se torne – se já não for – a maior da internet a reunir nossas lindas e talentosas mulheres de televisão. E vale nomes de canais de TV paga também. Participe!

E no final do post, um bônus: Top 10 das jornalistas mais lindas do mundo!

Jornalistas e apresentadoras de TV mais lindas do Brasil

Jornalistas e Apresentadoras mais belas da TV

Adriana Araújo

Adriana Araújo

Adriana Bittar

Adriana Bittar

Adriana Reid

Adriana Reid

Adriane Galisteu

Adriane Galisteu

Agda Queiroz

Agda Queiroz

Akemí Duarte

Akemí Duarte

Alana Rodrigues

Alana Rodrigues

Alessandra Consoli

Alessandra Consoli

Alice Bastos Neves

Alice Bastos Neves

Aline Bordalo

Aline Bordalo

Aline Machado

Aline Machado

Aline Malafaia

Aline Malafaia

Amanda Couto

Amanda Couto

Amanda Foschini

Amanda Foschini

Amanda Françozo

Amanda Françozo

Amanda Klein

Amanda Klein

Ana Bertozzo

Ana Bertozzo

Ana Carolina Oleksy

Ana Carolina Oleksy

Ana Carolina Raimundi

Ana Carolina Raimundi

Ana Cristina Pimenta

Ana Cristina Pimenta

Ana Elise Zogheib

Ana Elise Zogheib

Ana Furtado

Ana Furtado

Ana Hickmann

Ana Hickmann

Ana Luiza Castro

Ana Luiza Castro

Ana Luiza Guimarães

Ana Luiza Guimarães

Ana Paula Araújo

Ana Paula Araújo

Ana Paula Campos

Ana Paula Campos

Ana Paula Couto

Ana Paula Couto

Ana Paula Oliveira

Ana Paula Oliveira

Ana Paula Padrão

Ana Paula Padrão

Analice Nicolau

Analice Nicolau

Andrea Beron

Andrea Beron

Andrea Bueno

Andrea Bueno

Andressa Guaraná

Andressa Guaraná

Andressa Lorenzetti

Andressa Lorenzetti

Andressa Missio

Andressa Missio

Andressa Ramirez

Andressa Ramirez

Andressa Wolff

Andressa Wolff

Anelise de Oliveira

Anelise de Oliveira



Anne Lottermann

Anne Lottermann

Audrey Kleys

Audrey Kleys

Aurora Bello

Aurora Bello

Barbara Coelho

Barbara Coelho

Beatriz Castro

Beatriz Castro

Bel Mouta

Bel Mouta

Bianca Jhordão

Bianca Jhordão

Bianca Rothier

Bianca Rothier

Brenda Parmigianni

Brenda Parmigianni

Bruna Calmon

Bruna Calmon

Bruna Ramos Boyer

Bruna Ramos Boyer

Camila Bomfim

Camila Bomfim

Camila Busnello

Camila Busnello

Camila Martins

Camila Martins

Camille Reis

Camille Reis

Carla Cecato

Carla Cecato

Carla Fachim

Carla Fachim

Carla Vilhena

Carla Vilhena

Carol Barcellos

Carol Barcellos

Carol Guedes

Carol Guedes

Carol Minhoto

Carol Minhoto

Carol Nakamura

Carol Nakamura

Carol Teixeira

Carol Teixeira

Carolina Aguaidas

Carolina Aguaidas

Carolina Castelo Branco

Carolina Castelo Branco

Carolina Facchina

Carolina Facchina

Carolina Galan

Carolina Galan

Carolina Romão

Carolina Romão

Carolina Thomeu

Carolina Thomeu

Caroline Hasselmann

Caroline Hasselmann

Caroline Nogueira

Caroline Nogueira

Catarina Hong

Catarina Hong

Cátia Fonseca

Cátia Fonseca

Cecilia Flesch

Cecilia Flesch

Chris Flores

Chris Flores

Chris Nicklas

Chris Nicklas

Christiane Pelajo

Christiane Pelajo

Cindy Harada

Cindy Harada

Cíntia Lima

Cíntia Lima

Clarissa Góes

Clarissa Góes

Claudia Barthel

Claudia Barthel

Claudia Cruz

Claudia Cruz

Claudia Reis

Claudia Reis

Claudia Tenório

Claudia Tenório

Cleisla Garcia

Cleisla Garcia

Cristiana Gomes

Cristiana Gomes

Cristiane Dias

Cristiane Dias

Cristina Lyra

Cristina Lyra

Cristina Ranzolin

Cristina Ranzolin

Cristina Vieira

Cristina Vieira

Cynthia Benini

Cynthia Benini

Daiana Garbin

Daiana Garbin

Dani Calabresa

Dani Calabresa

Dani Monteiro

Dani Monteiro

Dani Scatolin

Dani Scatolin

Daniela Albuquerque

Daniela Albuquerque

Daniela Boaventura

Daniela Boaventura

Daniela Freitas

Daniela Freitas

Daniela Salerno

Daniela Salerno

Daniela Ungaretti

Daniela Ungaretti

Daniella Marcondes

Daniella Marcondes

Daniella Cicarelli

Daniella Cicarelli

Daysa Bellini

Daysa Bellini

Débora Aguillar

Débora Aguillar

Débora de Oliveira

Débora de Oliveira

Débora Meneses

Débora Meneses

Débora Vilalba

Débora Vilalba

Denise Félix

Denise Félix

Denise Luque

Denise Luque

Denise Odorissi

Denise Odorissi

Diana Bouth

Diana Bouth

Diana Rocha

Diana Rocha

Didi Wagner

Didi Wagner

Edieni Ferigollo

Edieni Ferigollo

Eduarda Peccinatti

Eduarda Peccinatti



Elaine Bast

Elaine Bast

Eliana Marques

Eliana Marques

Eliane Scardovelli

Eliane Scardovelli

Elisângela Carreira

Elisângela Carreira

Elisângela Colodeti

Elisângela Colodeti

Elizandra Carelli

Elizandra Carelli

Ellen Jabour

Ellen Jabour

Emilim Schmitz

Emilim Schmitz

Erica Reis

Erica Reis

Érika Okazaki

Érika Okazaki

Evelin Avancini

Evelin Avancini

Evelise Lais

Evelise Lais

Fabiana Boal

Fabiana Boal

Fabiana do Nascimento

Fabiana do Nascimento

Fabiana Fatoreto

Fabiana Fatoreto

Fabiana Oliveira

Fabiana Oliveira

Fabiana Panachão

Fabiana Panachão

Fabiana Scaranzi

Fabiana Scaranzi

Fabiane Kaczan

Fabiane Kaczan

Fabíola Figueiredo

Fabíola Figueiredo

Fátima Bernardes

Fátima Bernardes

Fernanda Burger

Fernanda Burger

Fernanda Cesaroni

Fernanda Cesaroni

Fernanda Gentil

Fernanda Gentil

Fernanda Lima

Fernanda Lima

Fernanda Lourenço

Fernanda Lourenço

Flavia Alvarenga

Flavia Alvarenga

Flávia Bonato

(À direita de Fabi Boal)

Flávia Freire

Flávia Freire

Flávia Noronha

Flávia Noronha

Flávia Peres

Flávia Peres

Flávia Ribeiro

Flávia Ribeiro

Flávia Scalzo

Flávia Scalzo

Flávia Scherner

Flávia Scherner

Gabriela de Palhano

Gabriela de Palhano

Gabriela Ferreira

Gabriela Ferreira

Gabriela França

Gabriela França

Gabriela Lisbôa

Gabriela Lisbôa

Gabriela Pasqualin

Gabriela Pasqualin

Gabriella Bordasch

Gabriella Bordasch

Gaía Passarelli

Gaía Passarelli

Geovanna Tominaga

Geovanna Tominaga

Gianne Albertoni

Gianne Albertoni

Gil Jung

Gil Jung

Giovanna Biotto

Giovanna Biotto

Gisah Batista

Gisah Batista

Gisele Ramos

Gisele Ramos

Giselle Camargo

Giselle Camargo

Giselle Hishida

Giselle Hishida

Gislaine Ferreira

Gislaine Ferreira

Glenda Kozlowski

Glenda Kozlowski

Glória Vanique

Glória Vanique

Greyce Feijão

Greyce Feijão

Heaven Delhaye

Heaven Delhaye

Ilze Scamparini

Ilze Scamparini

Ingrid Griebel

Ingrid Griebel

Isabela Tacaki

Isabela Tacaki

Isabella Fiorentino

Isabella Fiorentino

Izabella Camargo

Izabella Camargo

Izabela Drumond

Izabela Drumond

Jacqueline Brazil

Jacqueline Brazil

Janaina Jacobina

Janaina Jacobina

Janine Borba

Janine Borba

Jeniffer Cabello

Jeniffer Cabello

Jessica Biot

Jessica Biot

Jessica Leão

Jessica Leão

Jéssica Senra

Jéssica Senra

Jhenny Andrade

Jhenny Andrade

Joanna de Assis

Joanna de Assis

Joice Hasselmann

Joice Hasselmann

Josiane Cardoso

Josiane Cardoso

Joyce Ribeiro

Joyce Ribeiro

Júlia de Castro

Júlia de Castro

Julia Petit

Julia Petit

Juliana Góes

Juliana Góes

Juliana Perdigão

Juliana Perdigão

Juliana Rios

Juliana Rios

Juliana Rosa

Juliana Rosa

Juliana Silveira

Juliana Silveira

Juliana Verboonen

Juliana Verboonen

Kalinka Schutel

Kalinka Schutel

Karen Fabiani

Karen Fabiani

Karen Jonz

Karen Jonz

Karin Duarte

Karin Duarte

Karina Oliani

Karina Oliani

Karina Pachiega

Karina Pachiega

Karyn Bravo

Karyn Bravo

Kátia Scanferla

Kátia Scanferla

Katiúscia Neri

Katiúscia Neri

Kelly Pedrita

Kelly Pedrita

Keltryn Wendland

Keltryn Wendland

Laine Valgas

Laine Valgas

Laís Lacerda

Laís Lacerda

Lara Mota

Lara Mota

Larissa Israel

Larissa Israel

Leilane Neubarth

Leilane Neubarth

Leniza Krauss

Leniza Krauss

Letícia Gil

Letícia Gil

Letícia Henrique

Letícia Henrique

Letícia Levy

Letícia Levy

Letícia Wiermann

Letícia Wiermann

Lidiane Shayuri

Lidiane Shayuri

Ligia Mendes

Ligia Mendes

Liliam Queiroz

Liliam Queiroz

Lilian Coelho

Lilian Coelho

Lívia Braz

Lívia Braz

Lívia Raick

Lívia Raick

Livia Zuccaro

Livia Zuccaro

Lizi Benites

Lizi Benites

Lorena Calábria

Lorena Calábria

Louise Calegari

Louise Calegari

Luana Piovani

Luana Piovani

Luciana Ávila

Luciana Ávila

Luciana Camargo

Luciana Camargo

Luciana Gimenez

Luciana Gimenez

Luciana Magalhães

Luciana Magalhães

Luciana Yurie

Luciana Yurie

Luisa Mell

Luisa Mell

Luisa Micheletti e Erika Mader

Luisa Micheletti e Erika Mader

Luiza Zanchetta

Luiza Zanchetta

Luize Altenhofen

Luize Altenhofen

Maíra Lemos

Maíra Lemos

Maira Morais

Maira Morais

Manuela Queiroz

Manuela Queiroz

Mara Pinheiro

Mara Pinheiro

Marcela Silvestri

Marcela Silvestri

Marcela Varani

(À direita de Juliana Silveira)
Marcela Varani

Marcela Verasquim

Marcela Verasquim

Marcela Warzee

Marcela Warzee

Marcia Dantas

Marcia Dantas

Maria Beltrão

Maria Beltrão

Maria Cândida

Maria Cândida

Maria Júlia Coutinho

Maria Júlia Coutinho

Maria Paula Carvalho

Maria Paula Carvalho

Maria Paula Limah

Maria Paula Limah

Mariana Armentano

Mariana Armentano

Mariana Becker

Mariana Becker

Mariana Cartier

Mariana Cartier

Mariana Ferrão

Mariana Ferrão

Mariana Godoy

Mariana Godoy

Mariana Leão

Mariana Leão

Mariana Milagre

Mariana Milagre

Mariana Sasso

Mariana Sasso

Mariana Weickert

Mariana Weickert

Marília Ruiz

Marília Ruiz



Marina Araújo

Marina Araújo

Marina Ferrari

Marina Ferrari

Marina Mangione

Marina Mangione

Marina Miralha

Marina Miralha

Marina Person

Marina Person

Marina Santa Helena

Marina Santa Helena

Marisa Silva

Marisa Silva

Marisy Idalino

Marisy Idalino

Marta Gomes

Marta Gomes

Maryeva Oliveira

Maryeva Oliveira

Mayara Martins

Mayara Martins

Meiry Lanunce

Meiry Lanunce

Merie Gervásio

Merie Gervásio

Mica Rocha

Mica Rocha

Michelle Giannella

Michelle Giannella

Michelle Loreto

Michelle Loreto

Milena Machado

Milena Machado

Milene Domingues

Milene Domingues

Mirella Cunha

Mirella Cunha

Mirian Bottan

Mirian Bottan

Monalisa Perrone

Monalisa Perrone

Mônica Apor

Mônica Apor

Monica Iozzi

Monica Iozzi

Mônica Veloso

Mônica Veloso

Mylena Ciribelli

Mylena Ciribelli

Nadja Haddad

Nadja Haddad

Natalia Ariede

Natalia Ariede

Natália Leite

Natália Leite

Natalie Gedra

Natalie Gedra

Nathalia Arcuri

Nathalia Arcuri

Nayara Caroliny

Nayara Caroliny

Neila Medeiros

Neila Medeiros

Nubia Rose

Nubia Rose

Núria Saldanha

Núria Saldanha

Paloma Tocci

Paloma Tocci

Paola Manfroi

Paola Manfroi

Patrícia Abravanel

Patrícia Abravanel

Patrícia Calderón

Patrícia Calderón

Patricia Chueri

Patricia Chueri

Patrícia Costa

Patrícia Costa

Patrícia Ferraz

Patrícia Ferraz

Patrícia Maldonado

Patrícia Maldonado

Patrícia Nunes

Patrícia Nunes

Patrícia Poeta

Patrícia Poeta

Paula Aliende

Paula Aliende

Paula Menezes

Paula Menezes

Paula Monteiro

Paula Monteiro

Paula Sack

Paula Sack

Paula Valdez

Paula Valdez

Pietra e Luhanna

Pietra e Luhanna - Multishow

Poliana Abritta

Poliana Abritta

Priscila Casagrande

Priscila Casagrande

Priscila Kirsner

Priscila Kirsner

Pryscilla Paiva

Pryscilla Paiva

Rachel Sheherazade

Rachel Sheherazade

Rafaela Arns

Rafaela Arns

Rafaella Brites

Rafaella Brites

Rafaela Tomasi

Rafaela Tomasi

Raquel Rocha

Raquel Rocha

Regiane Tápias

Regiane Tápias

Regina Volpato

Regina Volpato

Renata Beccária

Renata Beccária

Renata Capucci

Renata Capucci

Renata Fan

Renata Fan

Renata Freitas

Renata Freitas

Renata Maranhão

Renata Maranhão

Renata Pitanga

Renata Pitanga

Renata Varandas

Renata Varandas

Renata Vasconcellos

Renata Vasconcellos

Rita Lisauskas

Rita Lisauskas

Roberta Marques

Roberta Marques

Roberta Piza

Roberta Piza



Rosana Jatobá

Rosana Jatobá

Sabina Simonato

Sabina Simonato

Sabrina Coelho

Sabrina Coelho

Sabrina Parlatore

Sabrina Parlatore

Sabrina Sato

Sabrina Sato

Samara Bastos

Samara Bastos

Sancler Frantz

Sancler Frantz

Sandra Annenberg

Sandra Annenberg

Sandra Fonseca

Sandra Fonseca

Sandra Redivo

Sandra Redivo

Sarah Oliveira

Sarah Oliveira

Silvana Ramiro

Silvana Ramiro

Silvye Alves

Silvye Alves

Simone Garuti

Simone Garuti

Solange Frazão

Solange Frazão

Sônia Campos

Sônia Campos

Stella Gontijo

Stella Gontijo

Susan Germer

Susan Germer

Suzana Schott

Suzana Schott

Suzi Martins

Suzi Martins

Taina Vizan Figueroa

Taina Vizan Figueroa

Tati Thomaz

Tati Thomaz

Tatiana Aude

Tatiana Aude

Tatiana Chiari

Tatiana Chiari

Tatyana Jorge

Tatyana Jorge

Teresa Morrone

Teresa Morrone

Thaís Azze

Thaís Azze

Thaís Dias

Thaís Dias

Thais Furlan

Thais Furlan

Thaís Margarido

Thaís Margarido

Thalita Oliveira

Thalita Oliveira

Thaynah Espinoza

Thaynah Espinoza

Thays Beleze

Thays Beleze

Ticiana Villa Boas

Ticiana Villas Boas

Tina Roma

Tina Roma

Titi Müller

Titi Müller

Valéria Monteiro

Valéria Monteiro

Valquiria Melnik

Valquiria Melnik

Vanessa Caubianco

Vanessa Caubianco

Vanessa Cochi

Vanessa Cochi

Vanessa Faro

Vanessa Faro

Vanessa Libório

Vanessa Libório

Vera Viel

Vera Viel

Wanessa Andrade

Wanessa Andrade

Williane Rodrigues

Williane Rodrigues



Jornalistas mais bonitas do mundo:

Se escolher as jornalistas e apresentadoras mais bonitas do Brasil foi uma missão impossível, que dirá selecionar as mais belas do planeta, certo? Mas temos que tentar e foi isso que eu fiz. Veja a seleção das mais belas jornalistas do planeta!

Adriana Monsalve (Venezuela)

Alessandra Balletto (Itália)

Arlett Fernández (México)

Ashley Russell (EUA)

Brenda Cavazos (México)

Carrie Milbank (EUA)

Charissa Thompson (EUA)

Charlotte Jackson (Inglaterra)

Erin Andrews (EUA)

Francesca Senette (Itália)

Georgie Thompson (Inglaterra)

Hazel Mae (Filipinas)

Heidi Watney (EUA)

Ilaria D’Amico (Itália)

Ines Sainz (México)

Jenn Brown (EUA)

Jennifer Sterger (EUA)

Jenny Scordamaglia (EUA)

Jenny Scordamaglia

Kirsty Gallacher (Escócia)

Kristen Berset (EUA)

Lara Álvarez (Espanha)

Lara Álvarez

Laura Lane (EUA)

Lindsay Soto (EUA)

Mayte Carranco (México)

Melanie Collins (EUA)

Melissa Stark (EUA)

Melissa Theuriau (França)

Mieke Buchan (Austrália)

Mirella Grisales (Colômbia)

Rula Jebreal (Palestina)

Sara Carbonero (Espanha)

Sophie Blake (Inglaterra)

Claudia Palacios (Colômbia)

Karolina Szostak (Polônia)

Karolina Sztovak

Tamara Ecclestone (Itália/Inglaterra)

Tamara Ecclestone

FOTOS: As fotos, em sua maioria, são de divulgação por parte das emissoras ou reproduções de imagens encontradas nos perfis de redes sociais das respectivas jornalistas e apresentadoras. Do contrário o crédito consta na própria imagem. Se algum autor identificar uma foto sua e não quiser ter o crédito incluído, basta avisar-nos que a mesma será imediatamente creditada ou removida, se assim desejado.

É isso. Curtiu nossa super lista com as mais belas jornalistas e apresentadoras de TV do Brasil e do mundo? Claro que existem centenas que merecem estar nesta lista. Por isso, mande sua sugestão!

Paulistano, atuou como designer de 1993 a 2008 quando começou o Curiosando, onde aborda diversos temas, além da cobertura do Miss Brasil desde 2010.

293 Comentários

  1. T Carvalho

    17 de julho de 2014 at 3:40 PM

    Jackeline Petkovic

  2. T Carvalho

    17 de julho de 2014 at 3:32 PM

    Procurem a jornalista Damaris Bubans da Record Brasília.
    Aliás a Record Brasília tem outras também.
    Venina Nunes….E a apresentadora,modelo,atriz,Gigi Monteirode SP.

  3. Junior

    16 de julho de 2014 at 4:33 PM

    Vanessa Martins Marcela Pierotti Cristiane Amaral jornalistas de santos

  4. marcos

    30 de junho de 2014 at 9:48 PM

    Pra mim sao todas lindas e maravilhosas e bem que podia me da uma..

  5. Bruno Macedo

    16 de junho de 2014 at 10:55 PM

    merecido ter a minha querida de MG Maira Lemos da Globo Minas

  6. Dilermando

    4 de maio de 2014 at 11:18 PM

    Fabiana Oliveira – Record MG
    Virgínia Nalon – Record MG
    Tainá Figuerôa – Record MG
    Ethel Corrêa – SBT Alterosa/ MG

  7. chicoca

    1 de maio de 2014 at 10:54 PM

    faltou a Tatiane Brasil.


    1 de maio de 2014 at 1:23 PM




    27 de abril de 2014 at 1:15 PM

    Pô amigos, tem muita mulher feia nesse meio aí ! Estão querendo fazer média dizendo que alguns "tribufús" são belas. Não vou nem revelar os nomes dos "tribufús" para não ficar mal, mas, tem muita "Mortiça" aí nessa lista.

  10. LILI

    1 de abril de 2014 at 12:36 PM


  11. LILI

    1 de abril de 2014 at 12:34 PM


  12. LILI

    26 de março de 2014 at 9:52 AM


  13. wagner

    25 de março de 2014 at 7:58 PM

    Maravilhosas!Sugiro a Priscila Brandão do Globo Rural.

  14. Michel

    13 de março de 2014 at 12:27 AM

    Faltou a Luciana liviero.

  15. voliver

    11 de março de 2014 at 1:53 PM

    Só faltou a belíssima Cecília Malan !!

  16. voliver

    11 de março de 2014 at 1:48 PM

    eiii , esqueceram a Cecilia Malan!!

  17. Beto

    24 de fevereiro de 2014 at 3:49 PM

    E a Hebe Camargos??rsrsr

  18. Manfrei

    24 de fevereiro de 2014 at 12:54 PM

    Faltou ou não vi a apresentadora do miami tv ? " Jenny Scordamaglia. ". Imperdível sempre com um vestido decotadíiiiiissimo !

  19. Marcos Paulo

    29 de janeiro de 2014 at 7:53 PM

    Faltou a Mariana Milagre e principalmente Raquel Rocha, ambas da rede record minas.

  20. César

    24 de janeiro de 2014 at 11:41 AM

    Bom dia,


    23 de janeiro de 2014 at 4:14 PM

    Faltou as apresentadoras da ALLTV, como a Debora Rodrigues e a Susana Lima

  22. Anônimo

    4 de janeiro de 2014 at 2:58 PM

    Grato pela inclusão de alguns nomes que indiquei. Porém, gostaria que colocasse também a Denise Félix, da RBS/SC. Ela também é muito gata!!!

    • Rodrigo Piva

      4 de janeiro de 2014 at 5:56 PM

      A Denise é linda mesmo, pena que não consigo foto, por isso não a add ainda. Mas assim que puder ela estará na lista.

      • Anônimo

        6 de janeiro de 2014 at 8:01 PM

        Ok. Obrigado pela consideração. Espero, então, publicação da foto de Denise Félix, gata da rbs/tv. Para ajudar, informo que ela é da regional de Itajaí. Faz reportagens em cidades catarinenses como Itajaí, Brusque, Balneário Camboriú, Itapema, Porto Belo… Envio, também, um link onde há uma foto dela. Espero ter ajudado. Abr.

        • Rodrigo Piva

          7 de janeiro de 2014 at 9:34 AM

          Ajudou sim. Eu até tinha visto essa foto, mas tentei encontrar outra maior. De qualquer forma, até localizar outra postei esta que sugeriu. Obrigado!!

          • Anônimo

            9 de janeiro de 2014 at 3:45 PM

            Ok, obrigado. Já vi a foto. Denise Félix é d+. Aguardo por outras fotos dela. Ela merece…

      • Rodrigo

        18 de fevereiro de 2014 at 6:32 PM

        Cara, falta aí a jornalista Evelin Avancini da Cultura. Antes era da Globo. Gata d+++++++

  23. Bulinário

    17 de dezembro de 2013 at 6:59 PM

    Chris Flores? Pelamordedeus!!! Muito feia pra estar aqui!!

    • luiz

      9 de fevereiro de 2014 at 9:18 AM

      vc é maluco!

  24. Daniel

    6 de dezembro de 2013 at 1:44 PM

    Falta incluir também: Letícia de Oliveira

  25. Neto

    3 de dezembro de 2013 at 6:59 PM

    Favor incluir a Bárbara Martins, Maria Beltrão e Ana Carolina Abar.

    • Junior Mendonça

      2 de janeiro de 2014 at 6:22 PM

      Maria Beltrão não pode ficar fora dessa lista, concordo contigo

  26. Casanova

    27 de novembro de 2013 at 11:06 AM

    Sinceramente, esta lista deveria se chamar: "As 350 Jornalistas e Apresentadoras mais requisitadas da TV Brasileira", porque tem muita mulher aí de beleza somente comum e não belas. Numa lista onde constam: Carla Modena, Geovana Teles, Gloria Maria, Julia Petit e Maíra Lemos e dizer que essas mulheres são belas, é querer fazer média com as mesmas e para não parecer preconceituoso.

  27. Anônimo

    19 de novembro de 2013 at 11:22 PM

    Coloquem a Denise Félix (RBS/SC), por favor!!! Essa repórter é muuuuuuuuuuuuiiiiiiiiiiiiiitttttttttttttttoooooooooooooo gaaaaaaaaatttttttttaaaaaaaa!!!!!

  28. Alan Lopes

    30 de outubro de 2013 at 8:43 PM

    Faltou a Daiane Fardin da RPCTV – filiada da globo – aqui de Curitiba

  29. Luiz

    30 de outubro de 2013 at 2:50 PM

    Faltou também a Márcia Manfro.

  30. Luiz

    30 de outubro de 2013 at 2:49 PM

    Faltou a Raquel Rocha da Record Minas Gerais.

  31. Rafa

    22 de outubro de 2013 at 1:20 PM

    Renata Fan, a mais linda e gostosa

  32. Olemar Borges

    15 de outubro de 2013 at 1:07 PM

    Por que não está aí a ANANDA APLE ???

    • Janjao

      6 de janeiro de 2014 at 11:45 PM

      Vixe…esse acabou de sair do xadrez…ta no queijo

  33. Luciel

    12 de outubro de 2013 at 11:39 PM

    ten as gauchas maira lessa e sabrina ongaratto rbstv e lucieli dornelles sptv

  34. Alex

    10 de outubro de 2013 at 6:29 PM

    Nesta semana eu vi a jornalista Mariana Palma na Globo em SP, ela é repórter do Bem Estar e está cobrindo o Salão Duas Rodas.
    Difícil achar foto dela mas ela aparece nos vídeos do Salão no G1. http://g1.globo.com/carros/assuntos/salao-duas-ro
    Segue a foto do Twitter: https://si0.twimg.com/profile_images/2267006795/i


  35. Luc_8456

    3 de outubro de 2013 at 11:12 AM

    Gostaria de sugerir ainda alguns nomes que vejo faltarem nessa belíssima coleção: Ana Paula Santos (do RJTV da Rede Globo), Ana Paula Mendes (do Inter TV Serra+Mar, jornalismo da Região Serrana do Rio de Janeiro), Cris Dias (do Globo Esporte) e Karina Monnerat (da TVC de Nova Friburgo).

  36. CaetanoHenrique

    24 de setembro de 2013 at 6:28 PM

    Falta incluir as jornalistas da RPC (Globo Curitiba) Ana Carolina Oleksy, faz a previsão do tempo no Paraná TV 1ª Edição (12:00 horas) e Claudia Celi ( faz previsão do tempo no Bom Dia Paraná (6:30 horas)

  37. Joel Alves

    10 de setembro de 2013 at 9:28 AM

    Faltaram a novidade Bruna Roma e Aurora Bello, além de Madeleine Alves e Valéria Grillo.

    A propósito, gostaria de saber o critério para definir jornalista: Tem que ter diploma ou atuar na área? Seja qual for, não entendo a inclusão de meras "celebridades" como Ana Hickmann e Luciana Gimenez. Nessa linha, vão considerar xuxa e ana maria braga também jornalistas (as minúsculas são propositais)


    • Rodrigo Piva

      10 de setembro de 2013 at 11:12 AM

      O título acho que deixa claro que a lista é de jornalistas e apresentadoras. :)

  38. Anônimo

    3 de setembro de 2013 at 12:27 PM

    Na minha opinião faltou também na lista outras três jornalistas: 1) Thaís Andrioli; 2) Denise Félix; 3) Sônia Campos; todas da RBSTV/SC. Coloca elas aí!!!!!

  39. Claudio

    28 de agosto de 2013 at 8:46 PM

    Debora Nigro, Sálua Zorkot… vou lembrando

  40. Claudio

    27 de agosto de 2013 at 7:31 PM

    opá; ainda esqueci, Soraya Lauand, Monize Poiani, Moniele Nogueira. Isabela Nascimento… afee, vou lembrando, vou mandando

  41. Claudio

    27 de agosto de 2013 at 5:32 PM

    faltou Aline MIdlej, Fernanda Bak, Gisele Gontijo, Roberta Marques e o q mais eu lembrar eu aviso… Abraço!!

  42. lcmoretti

    14 de agosto de 2013 at 7:29 PM

    Nessa lista faltou simplesmente a mais bonita e mais competente do brasil CRISTINA SERRA, essa é fera

  43. Yan

    4 de agosto de 2013 at 12:54 AM

    Eu tenho uma tara por Carol Barcellos !!!

  44. Anônimo

    1 de agosto de 2013 at 4:34 PM

    Falta a Carolina Bahia, RBS/SC, hoje correspondente da emissora em Brasília. Bota ela aí!!!

  45. Gustavo

    30 de julho de 2013 at 2:20 PM

    A lista estava indo razoavelmente bem até que eu vi a Glória Maria. Tive que recuperar o fôlego das risadas para poder comentar aqui…

  46. Anonimous

    16 de julho de 2013 at 11:52 AM

    Meu gosto é incomum xD
    Tem gente que olha pro corpo e fala que é bonita, tem outros que olham pro rosto e falam que é gostosa

    Eu destaco nessa lista:
    Andrea Bueno
    Bel Mouta
    Bianca Jhordão
    Carla Soraya
    Diana Bouth (PALMEIRENSE)
    Edieni Ferigollo
    Elaine Bast
    Eliana Marques
    Erica Reis
    Flávia Freire
    Gabriela Ferreira
    Gabriela França
    Glória Vanique***
    Jessica Biot
    Kalinka Schutel
    Lívia Raick
    Marina Ferrari
    Marisy Idalino
    Mirian Bottan****
    Monalisa Perrone
    Mônica Apor
    Mylena Ciribelli
    Nadja Haddad
    Patricia Sack

  47. Chuck

    12 de julho de 2013 at 5:19 PM

    faltou Chuck Norris!

  48. mg barros

    4 de julho de 2013 at 10:57 PM

    faltou a marcela araujo (sbt)!

  49. Deco Santos

    4 de julho de 2013 at 8:46 PM

    Sinceramente achei uma falha as ausencias de Monalisa Perrone que tem uma beleza exótica e a Mariana Godoy que tem um jeitinho todo meigo

    • Vânia

      4 de novembro de 2013 at 1:54 AM

      Mariana Godoy está na lista…

    • @driy_lima

      4 de março de 2014 at 9:58 AM

      A Monalisa Perrone certeza (:

  50. Anônimo

    2 de julho de 2013 at 3:37 PM

    Entre as jornalistas já apontas neste site, uma que eu acho super gata é a Ana Paula Araújo. Ela já está na casa dos 40 e, mesmo assim, é bonita demais. O sorriso dela é lindo pois irradia muita luz, podem reparar.

  51. Dilermando Lobo

    25 de junho de 2013 at 2:39 PM

    Faltou a bela Letícia Levy e a Flávia Alvarenga nessa lista.

  52. @CARIOCA_F1

    25 de junho de 2013 at 1:58 AM

    Vocês estão malucos cadê a Gabriela Mayer Ex apresentadora do Hora News agora na Cultura o coloca a menina ai a lista de vcs esta faltando ela rsrs para o Obrigado mas coloca ela

  53. Anônimo

    20 de junho de 2013 at 11:34 PM

    Brother, falta a Aurora Bello, do Sportv. Ela é muito gata!!!

  54. Jônatas

    14 de junho de 2013 at 8:24 PM

    O que a Carla Modena, Glória Maria e a Geovana Teles Está fazendo neste site???

  55. SÉRGIO

    11 de junho de 2013 at 1:50 PM


  56. catia regina

    6 de junho de 2013 at 12:18 PM

    faltou a nossa querida Renata Seliprim, ela é lindíssima

  57. Fã, apenas

    6 de junho de 2013 at 10:11 AM

    Karyn Bravo, Evelise Lais.. *—————————-*

  58. Felipe

    25 de maio de 2013 at 12:36 PM

    Vai desculpar mas a lista é totalmente sem critério. Colocar qualquer nome que a galera manda também não dá né? peralá, Lorena Barbier tá na mesma lista de Renata Vasconcelos! ai tem alguma coisa errada!!

    • Rodrigo Piva

      25 de maio de 2013 at 2:39 PM

      A lista é dos leitores, não reflete meu gosto pessoal, senão tenha certeza de que ela seria bem diferente… hahahaha
      Mas ficou maior quando foi mesclado apresentadoras + jornalistas, por isso algumas polêmicas se formaram. É aquela história de tudo tem prós e contras. Mas saiba que compartilho sua opinião, Felipe! Abraços :)

      • Felipe

        27 de maio de 2013 at 3:46 PM

        Pois é Rodrigo, mas quando vc cria uma lista que tem o titulo de as + belas, se vc coloca qualquer uma q a turma envia ai deixa de ser de belas porque o gosto é subjetivo e passa ser uma lista de jornalistas de modo geral, não necessariamente as + belas. Acho que você podia dar uma filtrada pq no fim das contas foi vc q criou a lista ou troca o título. Vlw ae, desculpa a crítica, hehe. Abraços

        • Rodrigo Piva

          27 de maio de 2013 at 3:52 PM

          Imagina, críticas só ajudam. Sem elas a coisa desanda! hahaha

  59. Remo

    25 de maio de 2013 at 11:30 AM

    Eu continuo a sugerir. Gisele Ramos, Ana Paula Gomes, Ruth Soares, Graziella Abrão, Lidia Duarte, Patricia Barros, Mara Pinheiro, Ana Paula Neves, Marcia Dantas, Ana Paula Oliveira.

  60. Remo

    24 de maio de 2013 at 11:43 AM

    Tem mais outras jornalistas belas. Carolina Aguaidas, Simone Queiroz, Solange Boulos, Liane Borges, Manuela Queiroz, Lívia Braz, Venina Nunes, Denise Campos de Toledo, Alessandra de Castro, Luciana Marques, Luciana Machado, Vivian Santos,Renata Maia, Louise Cardoso, Maria Ferri, Claudia Martins, Cintia Assunção, Cintia Godoy, Vera Morgado, Marcela Morato, Iana Coimbra, Maressa Sousa, Debora Nascimento, Gioconda Brasil, Geiza Duarte, Helóisa Torres, Tatiana Nascimento, Paula Moraes, Thais Furlan, Renata Marques, Munyque Fernandes, Gabriela Mayer, Fernanda Sampaio, Kristine otaviano, Evelyn Avancini, Evelyn Bastos, Beatriz Pereira, Anne Beckhauser, Fernanda de Andrade, Ana Cristina Pimenta, Fernanda Penna. Tem muito mais que gostaria de ver entre estas beldades que vocês publicaram.

  61. Remo

    24 de maio de 2013 at 11:17 AM

    Ainda falta muitas jornalistas belas. Juliana Perdigão, Simone Santos, Akemi Duarte, Fabiana Almeida, Viviane Possato, Luisa Torres, Maira Botelho, Natália Pereira, Maíra de Oliveira, Raquel Capanema, Ana Luisa Medici, Luciana Barreto, Aline Fonseca,Jaqueline Bogdezevicius,Aline Barcellos, Manuela Castro, Vivian Carvalho, Larissa Carvalho, Fabiana oliveira, Patricia Gomes, Shirley Barroso, Virginia Novick, Helen Oliveira e muitas outras.

  62. Marcelo Fonseca

    18 de maio de 2013 at 11:47 PM

    Coloca aí as apresentradoras/repórteres da Rede Globo Nordeste: Maira Morais, Clarissa Góis, Gabriela Lisboa, e Wanessa Andrade.
    Da Tv Tribuna (afiliada Bandeirantes) – Júlia de Castro e Taís Cintra.
    Procure as fotos dessas. Você não irá se arrepender.

  63. matheus

    15 de maio de 2013 at 10:09 PM

    FALTOU tambem a jornalista da record de brasil renata varandas

  64. Joel

    15 de maio de 2013 at 12:42 PM

    Glória Maria kkkkkkkkkk

  65. Eduardo

    15 de maio de 2013 at 3:35 AM

    Maria Júlia Coutinho??? Rodrigo, por favor, dá uma revisada nessa lista!

  66. /JJ

    8 de maio de 2013 at 2:02 PM

    cade a miriam leitão?….kkkkkkkkkkkkkkkkkkkkkkkkkkkkk

  67. Pedro_25

    1 de maio de 2013 at 3:25 PM

    Uma dica aí…Ana Paula Abrão – RedeTV – Reporter do TV Fama e extinto Manhã Maior.
    Muito linda. Alta, coxas grossas, cintura alvantajada…Sempre bem vestida….Sortudo é quem casar com ela…

  68. Manuela Borges

    25 de abril de 2013 at 7:01 PM

    A foto da repórter Manuela Borges está errada. Não sou eu!

    • Rodrigo Piva

      25 de abril de 2013 at 7:03 PM

      Obrigado pelo aviso, Manuela! Vou verificar imediatamente!!

  69. Antonio

    25 de abril de 2013 at 3:58 PM

    São muitas as beldades, entre elas eu escolho Ticiana villas boas, camila bonfim, Patricia poeta, rosana jatobá, caroline lara e Gabriela de palhano.

  70. Paolo Cesare

    22 de abril de 2013 at 3:07 PM

    A mais linda de todas elas é a Letícia Gil simplesmente maravilhosa!

  71. André Ricardo Lima

    19 de abril de 2013 at 10:52 PM

    As que fizeram meu coração disparar. Minha lista top 10:
    1 – Jéssica Senra
    2- Marisy Idalino
    3- Carla Vilhena
    4- Jeniffer Cabello
    5- Carol Barcellos
    6- Erica Reis
    7- Paloma Tocci
    8- Gislaine Ferreira
    9- Caroline Castelo Branco
    10- Juliana Silveira

    Só gata !!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!

    • adriano

      6 de janeiro de 2014 at 5:09 PM

      E a musa do globo Esporte, A Lindona Cristiane

  72. joãoluiz

    17 de abril de 2013 at 9:36 AM

    Quero foto de Michele Loreto,Marília Gabriela, Ana Furtado,e Glenda KOSLOVISK

    • joãoluiz

      18 de abril de 2013 at 12:16 AM

      Me lembrei da Renata Echeveria que trabalhou na globonordeste, por favor postar sua foto

  73. Dino

    15 de abril de 2013 at 6:57 PM

    Faltou a Josiane da Ric Record-Joinville e a Evelise Lais da Record Joinville-marcela Verasquim da Record joinville

  74. Matheus Romeiro

    7 de abril de 2013 at 12:49 PM

    Faltou nessa lista, a Barbara Coelho, reporter da Band Rio, e a Daniela Armentano, a moça do tempo do Jornal da Gazeta.


    30 de março de 2013 at 9:38 AM

    Paloma Tocci é a coisa mais linda dsse planeta.

  76. Helder Ferraz

    18 de março de 2013 at 8:16 PM

    Faltou Ilze Scamparine

  77. Marcos Souza

    13 de março de 2013 at 7:04 AM

    Glória Maria na lista? Caramba, meu, essa mulher é HORRÌVEL!

  78. joãoluiz

    2 de março de 2013 at 4:25 AM

    Na minha opinião Renata Vasconcelos é linda, e com aquelas .pernas então.F alta Beatriz Castro,e Meire Lanunce de PERNAMBUCO.

    • joãoluiz

      21 de março de 2013 at 10:25 AM

      A GRADEÇO PELAS FOTOS DE BEATRIZ CASTRO e Meire Lanunce que maravilha viva a globo nordeste

      • joãoluiz

        22 de março de 2013 at 12:43 AM

        Ainda falta Márcia Peltier,Isabela scalabrini, Mariana Ferrão´,claudia molina ou abujanra,Lorena Barbier,Claudia CRUZ, Michele Loreto,Bianca Carvalho, e a bela ANA furtado que show.

    • joãoluiz

      17 de abril de 2013 at 9:29 AM

      Peço o favor de postar foto atualizada de FÁTIMA BERNARDES no programa mais você cada vez mais linda.

  79. roberto

    2 de março de 2013 at 12:34 AM

    A Rede Record, esta de parabens, todas lindas e competentes, roberta marques e natalia leite, sao apaixonantes, nao desmerecendo as demais, alem de algumas de outras emissoras que são um espetaculo a parte.

  80. Edgar Fantin Barroso

    1 de março de 2013 at 1:56 AM

    A seleção ta boa, mas faltou uma morenaça linda e deliciosa da TV Brasil, a boazuda Jeniffer cabello. tem umas pernas que me deixam doido. Mas no time ai a Palominha Tocci é a que mexe com meu coração kkkkkkkk… sou doido por ela!!!!!!!!!!

  81. enlouquecer um homem

    20 de fevereiro de 2013 at 7:48 PM

    O Brasil é mesmo o país onde as mulheres são mais bonitas!! Grande seleção, qualquer uma delas deixaria um homem louco :)

  82. gilsoncalima

    2 de fevereiro de 2013 at 12:14 PM

    Keltryn Wendland
    Apresentadora do Jornal do Almoço de Lages-SC, na RBS TV/Globo.

  83. marcinhomclaren

    30 de dezembro de 2012 at 5:32 PM

    Da EPTV a Elisandra Carelli ? Cade a Kelly Godoy e a Iara Ruffini?

  84. Evamar Lopes Caetano

    19 de dezembro de 2012 at 1:11 AM

    Concordo que faltou Juliana Junger GloboMinas.

  85. vnd78

    14 de dezembro de 2012 at 2:00 AM

    Eliane Scardovelli…eu nao podia esquecer dessa DEUSA que não esta na relação acima…DELICIOSA

  86. vnd78

    14 de dezembro de 2012 at 1:51 AM

    Cristina Lyra EU TBM FICO SEM FOLEGO

  87. IsmaelCosta

    9 de dezembro de 2012 at 10:36 PM

    Só tem uma que me chama a atenção e não esta nessa lista, Leticia Gil, ô mulherão!!

  88. keilon

    2 de dezembro de 2012 at 9:04 PM

    Cadê a Mõnica Teixeira – Globo Rio?

  89. Luiz Antonio

    1 de dezembro de 2012 at 12:27 PM

    A Marina Araújo pode não ser a mais linda de todas, mas como é fofinha e simpática essa menina! O sorriso dela é 10.

  90. Luiz Antonio

    1 de dezembro de 2012 at 12:17 PM

    Me desculpem todos, mas beleza e bom gosto são fundamentais. CLAUDIA BARTHEL é lindíssima. E não só produzida. Certa vez ela apareceu sem nenhuma maquiagem na sua apresentação, parecendo ter saída aquela hora da cama. LINDÍSSIMA!

  91. Luiz Alberto

    12 de novembro de 2012 at 3:39 PM

    Cadê a Eliana Marques da rede GLOBO???

  92. Israel Scanferla

    23 de outubro de 2012 at 2:10 PM


  93. Zeidon

    4 de outubro de 2012 at 9:27 PM

    Fiquei encantado com essa loirinha (Emilim Schimitz) desde quando vi num site na qual leio. não foi atoa que mencionei ela para o curiosando? agora na FOX SPORTS posso vê-la todos os dias.


    29 de setembro de 2012 at 6:49 AM


  95. bruno

    13 de setembro de 2012 at 6:05 AM

    faltou a Renata fan e a kelly pedrita q na minha opinião é a mais bela do brasil a kelly ja foi eleita miss mundo paraná foi tbm terceiro lugar no miss mundo brasil 2007 foi rainha do café,foi miss top model brasil of the world,e venceu o maior concursos de modelos do mundo o miss model of world,miss américa fotogenia e hj ela é reporter do jogo aberto.

  96. Jblas

    1 de setembro de 2012 at 2:01 PM

    Faltou a bela Érica Reis do Band News

  97. José Carlos

    24 de agosto de 2012 at 9:42 AM

    Muito bom. Senti falta da CAroline Nogueira. Dá prá acrescentar???

  98. Gabriel

    7 de agosto de 2012 at 9:26 PM

    Faltou a Fernanda Cezaroni (Rede Vanguarda Vale do Paraíba – SP)

  99. Leo775

    30 de julho de 2012 at 12:35 AM

    Cara….. parabéns…..
    Excelente .. imagino o trabalho para localizar as fotos de todas essas divas e coloca-las aqui !!!!
    Muitas do Rio Grande do Sul, especificamente na metade sul……!!!

  100. R. Oliveiras

    24 de julho de 2012 at 11:04 PM

    Rodrigo, você está de parabéns! Eu pensava em reunir fotos de belas jornalistas, mas você já fez isso com uma quantidade muito maior de mulheres do que eu idealizava. Contrariando o estereótipo a que estamos (mal) acostumados, estas são mulheres bonitas e inteligentes. Agora, o difícil é saber qual é mais bonita.
    Sugiro que seja informado também a qual tv de qual cidade pertencem as belas. Ex: Ana Paula Padrão, TV Record, São Paulo, SP.

  101. @Vagnao101

    23 de julho de 2012 at 6:37 AM

    faltou debora menezes

  102. SERGIO

    7 de julho de 2012 at 2:15 PM


  103. TopMan

    5 de julho de 2012 at 8:02 PM

    Nessas listas faltou uma jornalista muito linda e charmosa que é a Joyce Hasselmann do Paraná no Ar, RICTV Curitiba. E também faltou a Adriana Consoli também da RICTV Curitiba.

    • TopMan

      5 de julho de 2012 at 8:09 PM

      E também sugiro a super gata Kátia Scanferla (RICTV Curitiba).

  104. Iago Bandeirante

    5 de julho de 2012 at 4:27 PM

    Gabriela Ferreira da Band Rio e Lívia Raick do SBT Rio.

    Essas duas são gostosas, hein! Kkk.

  105. Alex

    3 de julho de 2012 at 10:20 AM

    Além das que estão na lista gosto também da Maria Paula Carvalho. Ela apresentava o Via Brasil e agora está na Globo News.

  106. alexandre

    28 de junho de 2012 at 10:34 AM

    cadê a reporter Patricia Ferraz, da Rede Record, São Paulo

    • Rodrigo Piva

      28 de junho de 2012 at 11:14 AM

      Ela já está no post. Aparece antes da Patrícia Maldonado, dê uma olhada.

  107. luis da silva

    23 de junho de 2012 at 5:31 PM

    grande maioria lindas lindissimas q tal incluir a bianca carvalho eptv campinas .

  108. adao

    22 de junho de 2012 at 3:52 PM

    so faltou a lilia teles da tv anhaguera de goiás

  109. David Costa

    22 de junho de 2012 at 3:12 PM

    Faltou a Sophia Reis da A Liga da Band .

  110. Serginho

    9 de junho de 2012 at 5:14 PM

    Se a Juliana Rosa usasse sutiã menor daria um up!! Gata

    • Paulo

      13 de junho de 2012 at 9:19 AM

      Concordo Serginho!
      Que busto!!!
      Ela e a Cristiane Pelajo são as melhores!!
      Abaixo ao decote!!

  111. jean carlos

    7 de junho de 2012 at 3:06 AM

    sinseramente deveria ter dado mais atenção à Renata Vasconcelos,pois
    ela está entre as melhores e tambem faltou a katiuscia neri que é uma
    delicia e gata.

    • Francisco Matos

      24 de janeiro de 2014 at 4:38 PM

      Pra mim são todas bonitas e gostosas

  112. bobjulianoporto

    5 de junho de 2012 at 7:55 PM

    pra variar as mineiras são as mais lindas

  113. Renato

    4 de junho de 2012 at 6:58 AM

    Faltou a minha xará, a Renata Ceribelli…nossa, aquela mulher é um tesãooooooooo
    Faltou também a Luciana Ávila…muito gostosa

    • perseu

      7 de julho de 2012 at 8:27 PM

      ceribelli ta ai sim fiote!

  114. nardo

    2 de junho de 2012 at 9:09 PM

    Giuliana girardi



    • perseu

      7 de julho de 2012 at 8:27 PM

      ta ai uai, verifica la
      ta linda como sempre


    31 de maio de 2012 at 7:49 AM


  116. José Davi-CE

    31 de maio de 2012 at 2:00 AM

    Pra mim, faltou pelo menos 4 nessa lista: Leticia Gil-record (que bundão ela tem, GOSTOSSÍSSIMA), Ana Claudia Andrade-tv cidade fortaleza (loirinha show de bola, muito simpatica e bonita), Danielle Portela-tv verdes mares fortaleza (baixinha gostosa) e Adriana Dias-tv jangadeiro (tem uns olhos verdes que matam. O loirinha show. Pena que agora só é reporter). (não sei se pode. Mas colocaria tambem Amanda Estanislau-tv cidade fortaleza e Vera Viel-record news. Mas essas 2 não são jornalistas). Muito boa a lista, só gatas (com exceção de umas 2 ou 3 como a fatima bernardes). Show de bola.

  117. ailton jose ferreira

    29 de maio de 2012 at 1:31 PM

    sou fan da reporte quer faz tudo aver da rede recour

  118. Edmundo Menezes

    29 de maio de 2012 at 9:06 AM

    todas são lindissima mais faltou a loirissima Camila Maravilhowisk

  119. justino

    25 de maio de 2012 at 6:23 PM

    faltou a leilane neubarth da globo news

    • Vânia

      4 de novembro de 2013 at 2:05 AM

      Ela está aí na lista…

  120. Joao souza

    25 de maio de 2012 at 8:56 AM

    Cade caroline Hasselmann belissima!

  121. joaquim gilberto heg

    25 de maio de 2012 at 5:26 AM

    A mais linda fautou, Paola Manfroi da RPC

  122. Edu

    23 de maio de 2012 at 11:11 AM

    Coloca aí na lista a morena de olhos verdes da RIC aqui do Paraná a Valquiria Melnik.

    • perseu

      7 de julho de 2012 at 8:29 PM

      a penultima é ela mermao

  123. tiago santos monteir

    21 de maio de 2012 at 11:12 AM

    cade a leticia gil é a mais gata de todas

    • Casanova

      27 de novembro de 2013 at 11:15 AM

      Se voce olhar a lista até o fim e prestar mais a atenção, irá encontrar a Letícia Gil aí nessa lista.

  124. Olemar Borges

    21 de maio de 2012 at 11:05 AM

    O olhar da Roberta Marques me derrete.


    17 de maio de 2012 at 6:57 PM


  126. Olemar Borges

    16 de maio de 2012 at 11:22 AM

    Érica Reis – 10

    Carol Guedes – 10

    Cristina Lyra – 10

    Mariana Ferrão – 10

    Milena Machado – 10

    Roberta Marques – 10

    Ticiana Vilas Boas – 10

    Carol Barcellos – 10

    Luíza Zancheta – 10

    Poliana Abrita – 10

    Simone Garuti – 10

    Tina Roma – 1000000000000000000000

    • joao Barros

      26 de junho de 2012 at 9:30 AM

      Caroline Hasselmann- 10

  127. Olemar Borges

    16 de maio de 2012 at 7:10 AM

    Tina Roma, se juntar a beleza de todas as outras, não chega à metade da lindeza dela.


  128. Olemar Borges

    16 de maio de 2012 at 6:53 AM

    A TINA ROMA jogaria com a camisa 10 no meu time. Tina case comigo! Por favor!

  129. Olemar Borges

    16 de maio de 2012 at 6:47 AM

    Eu largaria tudo pra ir embora com a Tina Roma.

  130. robson james

    16 de maio de 2012 at 6:07 AM

    as mais lindas na minha opinião é Renata Vasconcelos que é uma gata linda eu chego ate sonhar com ela e em 2° vem patricia costa da record e Ciane neno da bandeirante (RBA) Belem

  131. ricardo

    12 de maio de 2012 at 1:34 AM

    o time da record, neste requesito é campeão, so tem fera, alem de lindas são inteligentes, na minha opinião, Roberta Marques, simplesmente linda, sou seu fã n. 1, acreditem.

  132. Nézio

    1 de maio de 2012 at 5:14 PM

    Espetáculo essa lista de mulheres lindas, mas tenho nomes que não estão e são lindas tambem, la vai: Cristina Ranzolin, Cristiane Silva, Daniela Ongarati, todas da RBS TV.

  133. Ramiro

    23 de abril de 2012 at 6:33 PM

    A Thatiana Brasil da Record é simplesmente maravilhosa.

  134. Nacim Sfier J&uacute

    23 de abril de 2012 at 6:17 AM

    Faltou nesta lista o nome da Giselle Camargo, da RPC, que demonstra simpatia e uma beleza estética muito linda.

  135. Feniano

    17 de abril de 2012 at 9:59 PM

    Porque Esqueceram a Ruiva Deliciosa e competente Milf Leilane Neubarth ????!!!!

  136. eduardo

    11 de abril de 2012 at 9:16 PM

    essa mariana becker parece um ex halterofilista da alemanha oriental. cade a renata fan?

  137. alex

    11 de abril de 2012 at 6:14 PM

    só deusas lindas…..d+ isso.

  138. ana

    10 de abril de 2012 at 3:42 PM

    a priscola casagrande e muito talentosa eu gosto muito dela ! um beijo enorme para voce priscila ! voce e linda !!!! bjs !!!!!!!!

  139. thyago souza

    10 de abril de 2012 at 8:30 AM

    Posso afirma, que nesse país não tem mutivo de vever na solidão! Para todas vocês parabens, são nossa razão de vida.

  140. jorge pinto de almei

    9 de abril de 2012 at 10:22 PM


  141. Adilnar Sereguello

    8 de abril de 2012 at 4:44 PM

    Discordo do WALTER que em janeiro disse que as apresentadoras morenas passam mais seriedade na notìcia.

    As notícias em sua maioria já são tão pesadas que o que precisa mesmo é de um ar de leveza então a mim não importa a aparência da moça e sim o seu preparo profissional, sua ética e o seu compromisso com a verdade e eu como professor da área me permito opinar com propriedade.

  142. Antônio Isidor

    8 de abril de 2012 at 4:33 PM

    A mais bela apresentadora e competente tambèm é sem dúvida a Adriana Reid; profissionalíssima e muito bonita!

  143. Paty B

    3 de abril de 2012 at 7:21 AM

    Algumas são realmente lindas, mas vamos combinar que algumas entraram por simpatia ou apenas para terminar a lista!!!

  144. Thais

    22 de março de 2012 at 12:17 PM

    Naõ é por ser minha irmã, ela é linda e agora esta na RIC TV Curitiba. quer ve-la ela esta no YouTube CAROLINE HASSELMAN

  145. Rita de Cassia

    22 de março de 2012 at 11:40 AM

    Faltou Caroline Hasselmann ex Record Salvador ela agora esta RIC TV Curitiba ela e'muito bonita!

  146. randra Morais

    22 de março de 2012 at 11:36 AM

    Faltou Caroline Hasselmann Ex record Salvador e agora esta na RIC TV em Curitiba ela e'muito bonita!

  147. Marcio

    14 de março de 2012 at 11:58 PM

    Gislaine ferreira Globo minas

  148. ilton rebello filho

    10 de março de 2012 at 12:29 PM

    kellly godoy eptv afiada globo sao carlos sp que baixinha maravilhosa

  149. Ronaldo

    8 de março de 2012 at 1:03 PM

    faltaram as meninas da TV GAZETA do ES, que colocam, muitas destas ai no bolso…., Poliana Alvarenga, Tati Braga, Rafaela Marquezine….e por ai vai….um abraço


    7 de março de 2012 at 12:17 PM

    Que legal minha sobrinha ( Carol Guedes) LINDISSIMA e minha prima Leniza Krauss ( Linda, parece tanto com minha mãe). São maravilhosas tanto em beleza quanto em profissionalismo……………

  151. Raul

    5 de março de 2012 at 12:56 PM

    A Mônica Apor não é Jornalista. E mesmo que fosse não é bonita, ela tem a boca torta

  152. Anônimo

    2 de março de 2012 at 12:46 PM

    Concordo, totalmente, com algumas jornalistas selecionadas: Ana Paula Araújo, Milena Machado, Paloma Tocci, Lidiane Sayuri, Patrícia Poeta, Rosana Jatobá… Não concordo com outras repórteres selecionadas, mas, enfim… Entretanto, na minha opinião, faltou, pelo menos, mais uma: Giovanna Teles. Acho ela gata demais. Insiram-na na lista, ok? Obrigado.

  153. @sirJorgeLuis

    1 de março de 2012 at 5:34 PM

    Além da Louise Calegari a qual já foi citada, indico a também baiana a bela da manhã: Jéssica Senra da Rede Record Bahia, segue o link da imagem: http://a0.twimg.com/profile_images/1548466716/twi

  154. master

    1 de março de 2012 at 4:29 PM

    Pow cade a mirian leitao !!$%$%@$@$!……..

  155. Ricardo

    29 de fevereiro de 2012 at 3:17 PM

    eu quero sugerir a Giselle Camargo. A mulher é um arraso! como posso mandar uma foto dela?

  156. Apaixonado

    26 de fevereiro de 2012 at 11:45 PM

    Fernanda Gentil, Renata Fan e Paloma Tocci S2 S2 S2

  157. José Padilha

    16 de fevereiro de 2012 at 10:08 PM

    …E la vai o meu time: Roberta Marque, Renata Fan, ágda Queiroz, Thalita Oliveira, Amanda Françozo, Carol minhoto, Ticiana Vilas Boas, Carla Cecato, Lidiane Sayuri, Fabiana Panachão, Nadja Hadadd, Patrícia Poeta, Andressa Wolf, Brenda Parmagianni, Carla fachim, Cláudia reis, Izabela Camargo, Michelle Gianella, Nathalia Guimarães, Milena Machado e Claudia Bartel – Qerem mais? Tenho anotado ainda o segundo e o terceiro time, e com um pouquinho de boa vontade faço mole mole o quarto time – Abração em todos.

  158. José Padilha

    16 de fevereiro de 2012 at 9:58 PM

    Pra mim a mais gata é: Roberta Marques.

  159. Marco Antonio

    15 de fevereiro de 2012 at 2:06 AM

    Thais Furlan (Record Londres)
    Beleza Clássica.

  160. valter

    6 de fevereiro de 2012 at 4:47 PM

    a agda queiroz e a mais linda de todas

  161. paulo

    6 de fevereiro de 2012 at 1:17 PM

    Paloma Tocci a gostosa da rede tv e melhor de tudo solteira essa sim só ta faltando sair na playboy….

  162. Luizão Batera

    6 de fevereiro de 2012 at 12:41 PM

    Faltou a Bianca Rothier, linda e com sua maravilhosa comissão de frente.

  163. sergio lopes

    5 de fevereiro de 2012 at 4:34 PM

    faltou a silvia popovich tenho um enorme tezao por ela

  164. Luiz Otavio Silva

    5 de fevereiro de 2012 at 3:55 PM


    Boa Tarde

    Fico muito feliz por ser paraense e de ter encontrado uma jornalista entre as mais bonitas do brasil VANESSA LIBORIO/RECORD BELEM.

    Parabens pela iniciativa do site mas voces deveriam incluir tambem a jornalista CARLA ALBUQUERQUE/TV LIBERAL BELEM.


    Otavio Silva

  165. Paulinho Ferreira

    1 de fevereiro de 2012 at 4:06 PM

    Com certeza podem acrescentar Jessica Leão : confiram e me digam se não estou certo. As duas apresentam programas no Cnal Net Cidade de Mogi das Cruzes

  166. Paulinho Ferreira

    1 de fevereiro de 2012 at 2:09 PM

    Com certeza podem acrescentar Jessica Leão : confiram e me digam se não estou certo. <a href="http://www.megashopmogi.com.br” target=”_blank”>www.megashopmogi.com.br

  167. Lucas

    24 de janeiro de 2012 at 3:08 AM

    Esqueceram da Aurora Bello,do Sportv!

  168. AGNALDO

    23 de janeiro de 2012 at 12:51 AM

    Em meio a tantas mulheres lindas, ainda falta minha apresentadora e repórter
    favorita e linda. LARA MOTA, ric tv, programa BALANÇO GERAL E JORNAL DA RECORD PR,

  169. Alessandro

    16 de janeiro de 2012 at 4:00 PM

    Muito bom, mais algumas, Karine Garcia (RPC Paraná) e Vanessa Rumor (RPC).

  170. Joel Alves

    16 de janeiro de 2012 at 9:07 AM

    Faltou a Silvia Damasceno. A propósito, por onde ela anda?

  171. Alessandro Zanettini

    12 de janeiro de 2012 at 4:31 PM

    Faltaram algumas ai, vai lá: Luciana Magalhães (Gazeta); Carolina Romão (RIT TV); Agda Queiroz (Record).

  172. Marcelo

    11 de janeiro de 2012 at 7:26 PM

    Faltou a Renata Saporito do BandSports. Filézinho.. muito gata.

  173. moacyr dasartes

    11 de janeiro de 2012 at 5:35 PM

    apaixonante esta renata

  174. Um Sonho!

    3 de janeiro de 2012 at 1:48 AM

    Mariana Leão é Tudo!!! Ai se eu te pego….!

  175. monique

    30 de dezembro de 2011 at 4:56 PM

    mariana ferrao conseteza e a maisssssssssssss limda!!@!@!@!

  176. wallace

    21 de dezembro de 2011 at 1:14 PM

    Parabéns pela lista!
    Renata Maranhão é um espetáculo!

  177. rick

    17 de dezembro de 2011 at 12:49 AM

    juliana rosa/globonews

  178. Marco Antonio

    13 de dezembro de 2011 at 1:07 PM

    PARA SER ACRESCENTADO: (sem falta)
    Claudia Barthel (Rede TV)
    Marina Person
    Regiane Tápias (Gazeta)
    Carol Minhoto (Gazeta)
    Stella Gontijo (Gazeta)
    Regina Volpato (Rede TV)
    Priscylla Paiva (Record News Tempo)
    Roberta Marques (Record News)
    Amanda Françozo (Record News)
    Mônica Iozzi (CQC)
    Lorena Calábria
    Mônica Veloso (SBT)
    Patrícia Costa (Record / Record News)

  179. Felippo

    6 de dezembro de 2011 at 12:41 AM

    Luiza Zanchetta, Priscila Casagrande,

  180. ANINHA

    3 de dezembro de 2011 at 8:51 PM

    Só aparece as jornalistas da tv e as de redação e assessoras?

    • Rodrigo Piva

      3 de dezembro de 2011 at 9:03 PM

      A ideia inicial era apenas as jornalistas de TV por obviamente ser bem mais fácil de selecionar, mas nada impede que sejam incluídas as belas das redações. O céu é o limite. Se quiser já pode deixar aqui suas indicadas. :-)

  181. Claudio

    3 de dezembro de 2011 at 4:37 PM

    Tenho uma sugestão: Mayara Martins, do SBT da região de Campinas SP (salvo engano). Pode conferir. É pura Beleza.

  182. Alex

    3 de dezembro de 2011 at 10:04 AM

    Tá faltando nesta lista a Fabiana Panachão, da Record News, ela é muito linda.

  183. Maykon

    2 de dezembro de 2011 at 3:30 AM

    Mariana Becker da Formula 1. E outra, se tem Carla Vilhena e Sandra Anenberg, pode ter a Fátima Bernardes também, ne?

  184. Felippo

    1 de dezembro de 2011 at 12:54 PM

    Heleine Hering

  185. Filippo

    1 de dezembro de 2011 at 12:51 PM

    Daniela Salerno, Daisa Belini, Cristina Scaff, Vanessa Libório, Camila Busnello,
    Leniza Krauss, Adriana Bittar, Cristiana Gomes, Flavia Scalzo, Louise Calegari,
    Ingrid Griebel, Juliana Alvarenga, Mylena Ciribeli …

  186. José Carlos

    24 de novembro de 2011 at 1:42 PM

    Poxa sem palavras huauuuuu!!!!

  187. William Marques

    24 de novembro de 2011 at 12:11 AM


  188. neri

    22 de novembro de 2011 at 9:18 AM

    Nadja Haddad da Band (vcs erraram o nome na legenda da foto) bate de longe nas concorrentes

  189. José Murilo

    12 de novembro de 2011 at 4:27 PM

    Pra mim, a Natalie Gedra (Band) já venceu esta lista. Natalie Gedra é a repórter mais bonita do momento.

  190. Felippo

    1 de novembro de 2011 at 7:10 PM

    faltou a, Patricia Ferraz, Manuela Borges, Andrea Beron, Cleisla Garcia, Merie Gervásio, Lorena Coutinho,
    Thatiana Brasil, Denise Odorissi …

    • Felippo

      1 de dezembro de 2011 at 11:19 AM

      Leticia Gil, Venina Nunes, Janine Borba

  191. Daniel Souza

    17 de agosto de 2011 at 7:07 AM

    Eu sugiro a Juliana Verboonen do Gazeta News e do Tempo do Jornal da Gazeta é a mais linda na minha opnião alem de muito simpatica.

    E a Luciana Camargo também do Jornal da Gazeta.

  192. Frank Cesar

    16 de julho de 2011 at 12:46 AM










    Rostos E Aeroportos

    Camisa de Vênus

    Vou vestir a minha sombra

    Preciso me proteger

    Eu sempre manejei bem as palavras

    Mas agora não sei o que dizer

    Sua voz tão calma e fria

    Penetrou tão lentamente

    Congelou o meu orgulho

    Embaçou a minha mente

    Vejo seu rosto nos aeroportos

    Nas ruas, nos cinemas, nos jornais

    Vejo seus olhos nos faróis de meu carro

    A noite eles sempre brilham mais


    Todas As Canções


    Sei que o Teu Amor não mudou,

    Mesmo depois dos meus erros.

    E a Tua mão está sobre mim pra me guiar,

    Cada dia vou viver pra Te louvar

    Pra te adorar, enquanto eu respirar

    Todas as canções do universo

    Não irão dizer o que eu sinto

    Mas espero que os meus versos

    Possam agradar Teus ouvidos

    Todas as canções do universo

    Não irão mostrar o que eu sinto

    Mas espero que os meus versos

    Possam alcançar o infinito

    Hoje estou aqui pra dizer,

    Que a minha voz não é nada

    Sem a unção que está sobre mim,

    Pra me guiar

    Cada dia vou viver pra te louvar

    Pra te adorar, enquanto eu respirar

    Todas as canções do universo

    Não irão dizer o que eu sinto

    Mas espero que os meus versos

    Possam agradar Teus ouvidos

    Todas as canções do universo

    Não irão mostrar o que eu sinto

    Mas espero que os meus versos

    Possam alcançar o infinito

    • Frank Cesar

      17 de setembro de 2011 at 9:06 PM











  193. Rosalvo Rosa

    5 de julho de 2011 at 4:00 PM

    Tá faltando muita gente nessa lista. Uma delas, a Camila Bonfim.

  194. caio

    15 de junho de 2011 at 1:47 PM

    Falta a Andresa Guaraná, da TV Bandeirantes na lista 1. Ela eh muito gata, deusa. Ja vi ao vivo. Eh muito gostosa.

    • Romarlo Marcassi

      4 de julho de 2011 at 5:14 PM

      Thays Beleze é a mais linda, mais charme Thays Beleze é tudo de bom.

  195. Claudemir Cassiano

    30 de maio de 2011 at 6:56 AM

    Conconrdo com o Marco Antonio e acrescento a Jaqueline Brasil da Rede Globo (Radar SP).


  196. Vanderlei

    25 de maio de 2011 at 6:20 AM

    A Agda Queiroz é uma deusa da beleza, essa mulher é damais…

    todas mencionadas acima são belas, mas a Agda falta-me comentarios sobre sua beleza, simplesmente damais…

  197. jones

    20 de maio de 2011 at 8:38 AM

    tbm faltou diana rocha record rio de janeiro

  198. Zeidon

    22 de abril de 2011 at 2:42 PM

    Interessante essa do Thiago Liefert, sou mais a Emilim Schmitz, mais essa loirinha dos pampas e do Liefert e gostosa.


    19 de abril de 2011 at 1:52 PM


  200. zeidon

    16 de abril de 2011 at 12:58 AM

    Essa lista tá interessante, mas vocês esqueceram de colocar três jornalistas de Santa Catarina:Camille Reis, Laine Valgas e aquela loirinha show de bola, chamada Emilim Schmitz, e um pouco parecida com a Ellen Rocche.

  201. Cezar

    6 de abril de 2011 at 6:12 PM

    A lista tá boa, mas num é só as mais belas, tem todas as jornalistas conhecidas.

  202. lucash

    6 de abril de 2011 at 12:01 AM

    fernanda gentil nao eh mais mais bonita…mais eh coisa lindiiia!

  203. Marco Antonio

    28 de março de 2011 at 9:44 AM

    Thalita Oliveira (Record)

    Bota Aí!!!

  204. Marco Antonio

    28 de março de 2011 at 9:36 AM

    Essa Também vale a pena:

    Claudia Tenório (Rede Vida)

  205. Marco Antonio

    28 de março de 2011 at 9:33 AM

    Sugiro encrementar esta lista com as presenças de:

    Carla Cecato (Record)

    Roberta Piza (Record)

    Patrícia Costa (Record)Tempo

    AnaLice Nicolau (SBT)

    Chris Flores (Record)

  206. celso

    25 de março de 2011 at 10:18 AM



    16 de março de 2011 at 12:16 PM

    Acho que voces não gostam das "Natalias" A Natalia Leite chega a abusar de ser bonita. E a Natalia Guimarães então ? ah ah ?

  208. flavio

    12 de março de 2011 at 9:20 AM

    não esqueça de jackeline brazil , radio sulamenrica transito e sptv


  209. Bill

    25 de fevereiro de 2011 at 12:02 AM

    Marilia Ruiz??? nada a ver, faltou ai a Mariana Godoy


    22 de fevereiro de 2011 at 6:33 PM


  211. Vinicius Silva

    19 de fevereiro de 2011 at 9:46 AM

    Essa Daiana Garbin é linda. Estou apaixonado. *_*

  212. Paulo Solon

    16 de fevereiro de 2011 at 10:03 PM

    A Gabriela de Palhano é uma gata. Ela comecou a carreira aqui em Fortaleza e hj esta em Sao Paulo. Outra muito bonita tb eh a Mariana Sasso, da Tv verdes Mares.

  213. Gino

    9 de fevereiro de 2011 at 2:01 PM

    Quem um dia faou que mulher bonita é mulher burra, errou totalmente, e a prova são essas lindas e inteligentes mulheres da nossa televisão.

    Parabéns pela homenagem a elas.

  214. Curiosidade

    24 de janeiro de 2011 at 12:42 AM

    Carla Soraya da Tv Diário de Fortaleza

  215. Celso Regis

    19 de janeiro de 2011 at 12:21 PM

    Esta lista é muito bonita mas nem precisava enfatizar como as mais lindas. Afinal. todas são lindíssimas. Fou uma delícia vê-las reunidas. Grande idéia.

  216. Apostas Online

    16 de janeiro de 2011 at 10:51 PM

    adorei Luize Altenhofen :D

  217. Eu

    16 de janeiro de 2011 at 5:14 AM

    Thays Beleze (PR)

    Renata Maranhäo

    Poliana Abritta

    Luciana Avila

    Carla Fachim (RS)

  218. RafaH

    15 de janeiro de 2011 at 8:12 PM

    Vou Destacar 3 em duas listas pq tem algumas mulheres ai que são mais pra modelos isso sim.

    Jornalistas :

    1_Cynthia Benini(Além de linda mto carismatica)

    2_Renata Maranhão(Sem comentarios *-* )

    3_Ana Paula Padrão(Uma beleza classica ao meu ver)

    Jornalismo Esportivo:

    1_Ana Luiza Castro (Que par de olhos azuis são aqueles OMG???)

    2_Renata Fan (Simplismente miss Brasil 1999)

    3_Luize Altenhofen (Beleza Americana.)

  219. Incógnita

    13 de janeiro de 2011 at 8:49 PM

    Nossa, tem uma muito linda,no ''Tudo a ver'' da Record,mas esqueci o sobrenome dela.O nome dela é Nathália/Natália.Não sei se é a Arcuri,mas a Arcuri não é do Tudo a ver (acho).Mas a Nathália Arcuri a mais linda dai,na minha opinião. (:

  220. Estilo Namorador

    13 de janeiro de 2011 at 8:08 PM

    Essa IZABELA CAMARGO é linda ate sem maquiagem.

  221. Malk

    13 de janeiro de 2011 at 7:09 PM

    Cadê as gostosas da Mônica Waldvogel, Lilian Wite Fibe e Marilia Gabriela?

  222. artur Barz

    13 de janeiro de 2011 at 1:19 PM

    Tem uma ancora aki de Santa catarina q eh bem gostosa…Acho q apresenta a revista santa catarina aos domingos…Porra, ela humilha muita modelo, pqp…

  223. iED

    13 de janeiro de 2011 at 12:41 PM

    Outra vez esqueçeram da Williane Rodrigues do SBT! Ò__ó

  224. Pablo

    13 de janeiro de 2011 at 12:37 PM

    Muito bom o seu blog, ja estou seguindo.

    Segue o meu tbm: http://saudedehomem.blogspot.com/

    Parceria? Adicione: saudedehomem@hotmail.com no MSN para conversarmos.

  225. José Carlos

    13 de janeiro de 2011 at 12:02 PM

    Gostei do Post!

    Conheça o agregador http://www.garimpoweb.com

    Divulgue seus links!

    Milhares de visitas diarias.

  226. Victor

    13 de janeiro de 2011 at 11:18 AM

    A Tatiana Chiari da Rede Record também é muito gata.

  227. Marcelo Eliel

    13 de janeiro de 2011 at 10:40 AM

    Glenda Kozlowski ?? só pode ser brincadera … ¬¬

  228. felipe

    13 de janeiro de 2011 at 9:29 AM

    a maais linda é a chris dias, mas a débora vilalba é maravilhosa demais tb =)

  229. Anonimo

    13 de janeiro de 2011 at 9:21 AM

    AFew, as mais bonitas? tem mmt gata ai, mas tem umas que exageraram, pq nao poe tb a mulher do willian bonner ja que é pra esculaxar…afew…

  230. Paulo Cesar gotijo

    13 de janeiro de 2011 at 9:09 AM

    Faltou a Elisangela Carreira da Band Interior.

  231. #ficadica

    13 de janeiro de 2011 at 8:42 AM

    Faltou a Nathalia Arcuri, que foi até cantada pelo Jon Bonjovi durante entrevista!


  232. Cdr

    13 de janeiro de 2011 at 8:26 AM

    Falto a mais linda de todas: Thays Beleze da RPC TV: segue a foto http://1.bp.blogspot.com/_v7DVMJbjHEM/TM4Z2B1oPKI

  233. fernanda

    13 de janeiro de 2011 at 8:20 AM

    Gostei do Post! Já pensou em divulgar também no http://www.plik.com.br ?

  234. Cadelis

    13 de janeiro de 2011 at 8:14 AM

    Karine Garcia da RPC (Paraná). Pena q nao esta na lista, na minha opiniao uma das mulheres mais belas da Tv Brasileira…

  235. Victor

    13 de janeiro de 2011 at 6:19 AM

    Faltou a Sabina Simonato, repórter do SP-TV (rede Globo)

  236. AnonimodoRJ

    13 de janeiro de 2011 at 12:50 AM

    Monica Apor humilha todas!!!

  237. Pablo

    12 de janeiro de 2011 at 7:10 PM

    Fabiane Kaczan é PERFEITA, gata demais e ainda quase ganhou 1 milhão no 1 contra 100

  238. Leonardo

    12 de janeiro de 2011 at 3:27 AM

    Eu quero saber aonde esta a Gisele Ishida da Band News??????!!!!!!

    A apresentadora oriental mais bonita da tv brasileira!!!!

  239. Rone Brito

    10 de janeiro de 2011 at 1:16 PM

    Fernanda Gentil do sportv

    Patricia Chueri da Band

  240. Nonato Albuquerque

    8 de janeiro de 2011 at 5:59 PM

    Fabiane Kaczan, apresentadora do Esporte Jangadeiro na TV Jangadeiro de Fortaleza não fica nada a dever a essa (excelente) lista.

  241. Fera

    8 de janeiro de 2011 at 5:27 PM

    faltou também a Adga Queiroz, linda!!!!


  242. JUNIOR

    8 de janeiro de 2011 at 5:26 PM


  243. Ðαη&io

    8 de janeiro de 2011 at 4:25 PM

    As mais lindas são: FLÁVIA FREIRE e DÉBORA VILALBA

    Casaria com qualquer uma das duas!

  244. steve vai

    8 de janeiro de 2011 at 3:58 PM

    onde está a Poliana Abritta???????????????????????

  245. daniel

    8 de janeiro de 2011 at 3:07 PM

    marilia ruiz cara, ta de brincadeira

  246. Gustavo

    8 de janeiro de 2011 at 12:20 PM

    vocês não assistem ao jornal Hoje da globo não?

  247. Rafa

    8 de janeiro de 2011 at 10:52 AM

    Renatas… Maranhão e Vasconcelos.


    Tem duas loiras na Globo de SP que são lindas tbm, Diana Garbim e Natalia Ariede.

  248. Walter

    8 de janeiro de 2011 at 9:47 AM

    Só gatas, as morenas acho que são maioria, passam um ar mais sério a notícia.

  249. @Bruno_Barman

    8 de janeiro de 2011 at 9:33 AM

    Boa a lista, só faltou a Cindy Harada do Band Sportes e a Cristiane Pelajo do Jornal da Globo.

  250. Zaca

    8 de janeiro de 2011 at 9:32 AM

    Faltou a mais linda de todas. Carol Barcelos, do RJ

  251. PedroPK

    8 de janeiro de 2011 at 8:09 AM

    Faltou a melhor!

    Poliana Abritta:

  252. Rafael Avelino

    7 de janeiro de 2011 at 4:51 PM

    A paloma Tocci e a Michele do gazeta Esportiva são gatissimas!!!rs

  253. Gabriel Meissner

    7 de janeiro de 2011 at 10:19 AM

    A melhor na minha opinião é a Patrícia Poeta! Gata!


O seu endereço de email não será publicado Campos obrigatórios são marcados *

Você pode usar estas tags e atributos de HTML: <a href="" title=""> <abbr title=""> <acronym title=""> <b> <blockquote cite=""> <cite> <code> <del datetime=""> <em> <i> <q cite=""> <strike> <strong>